ID: 922504831

View in Genome Browser
Species Human (GRCh38)
Location 1:226120503-226120525
Sequence TGGGAGTCCCCAAGCCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922504820_922504831 25 Left 922504820 1:226120455-226120477 CCAGAGAGATGCCCTACTGAGTT No data
Right 922504831 1:226120503-226120525 TGGGAGTCCCCAAGCCAGGTGGG No data
922504823_922504831 13 Left 922504823 1:226120467-226120489 CCTACTGAGTTTGGCAATGCTGT No data
Right 922504831 1:226120503-226120525 TGGGAGTCCCCAAGCCAGGTGGG No data
922504822_922504831 14 Left 922504822 1:226120466-226120488 CCCTACTGAGTTTGGCAATGCTG No data
Right 922504831 1:226120503-226120525 TGGGAGTCCCCAAGCCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922504831 Original CRISPR TGGGAGTCCCCAAGCCAGGT GGG Intergenic
No off target data available for this crispr