ID: 922510125

View in Genome Browser
Species Human (GRCh38)
Location 1:226158759-226158781
Sequence CTGGTTCTGCAGAGCTAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 139}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922510125_922510127 -9 Left 922510125 1:226158759-226158781 CCAATCTAGCTCTGCAGAACCAG 0: 1
1: 0
2: 0
3: 9
4: 139
Right 922510127 1:226158773-226158795 CAGAACCAGCCCATGGTCTTAGG 0: 1
1: 0
2: 2
3: 49
4: 261
922510125_922510132 -2 Left 922510125 1:226158759-226158781 CCAATCTAGCTCTGCAGAACCAG 0: 1
1: 0
2: 0
3: 9
4: 139
Right 922510132 1:226158780-226158802 AGCCCATGGTCTTAGGGCAGGGG 0: 1
1: 0
2: 2
3: 25
4: 196
922510125_922510131 -3 Left 922510125 1:226158759-226158781 CCAATCTAGCTCTGCAGAACCAG 0: 1
1: 0
2: 0
3: 9
4: 139
Right 922510131 1:226158779-226158801 CAGCCCATGGTCTTAGGGCAGGG 0: 1
1: 0
2: 1
3: 11
4: 140
922510125_922510130 -4 Left 922510125 1:226158759-226158781 CCAATCTAGCTCTGCAGAACCAG 0: 1
1: 0
2: 0
3: 9
4: 139
Right 922510130 1:226158778-226158800 CCAGCCCATGGTCTTAGGGCAGG 0: 1
1: 0
2: 1
3: 14
4: 191
922510125_922510136 15 Left 922510125 1:226158759-226158781 CCAATCTAGCTCTGCAGAACCAG 0: 1
1: 0
2: 0
3: 9
4: 139
Right 922510136 1:226158797-226158819 CAGGGGAGTCCTCCCACTGGAGG 0: 1
1: 0
2: 1
3: 21
4: 192
922510125_922510135 12 Left 922510125 1:226158759-226158781 CCAATCTAGCTCTGCAGAACCAG 0: 1
1: 0
2: 0
3: 9
4: 139
Right 922510135 1:226158794-226158816 GGGCAGGGGAGTCCTCCCACTGG 0: 1
1: 0
2: 3
3: 20
4: 228
922510125_922510128 -8 Left 922510125 1:226158759-226158781 CCAATCTAGCTCTGCAGAACCAG 0: 1
1: 0
2: 0
3: 9
4: 139
Right 922510128 1:226158774-226158796 AGAACCAGCCCATGGTCTTAGGG 0: 1
1: 0
2: 1
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922510125 Original CRISPR CTGGTTCTGCAGAGCTAGAT TGG (reversed) Intronic
900713712 1:4130678-4130700 CTGGTTCTGAAGGGCCAGGTTGG + Intergenic
902032244 1:13431278-13431300 CTAGTCCTGCAGATCTGGATGGG + Intergenic
906218824 1:44061242-44061264 CTGTTTCTCCAGGGCTAGACAGG + Intergenic
907722389 1:56984108-56984130 CTTGTTCTGCAGTGCTAGCGGGG + Intergenic
911168280 1:94744628-94744650 CTGGTTCTCCTGAGCCAGAATGG - Intergenic
912147733 1:106814691-106814713 CTGATTCTGCAGAGATTTATAGG - Intergenic
912211837 1:107564891-107564913 CTGTTTCTGCATAGTTAGAATGG - Intergenic
916499304 1:165373334-165373356 CTGTTCCTGCAGAGCAGGATGGG + Intergenic
917513919 1:175691192-175691214 GTGGCTCTGCAGAGCAGGATGGG + Intronic
920176170 1:204103305-204103327 CTGGTCCAGCAGAGATAGAATGG - Intronic
922510125 1:226158759-226158781 CTGGTTCTGCAGAGCTAGATTGG - Intronic
1065828641 10:29595059-29595081 CTGGTTTTGCAGATGTAGAGTGG - Intronic
1067937835 10:50625521-50625543 CTGGTTCTGTAGGTCTAGGTGGG - Intergenic
1071236617 10:83657277-83657299 CTGGGTCTGCAAAGCCAGCTTGG + Intergenic
1072954065 10:99873571-99873593 CTGGATCTGCAGAGCTGGAAGGG + Intergenic
1073181916 10:101588475-101588497 CTGGGTCGGCAGAGCTGGAAGGG + Intronic
1073307947 10:102517808-102517830 CTGGTTCTCAAGAGCTTGGTAGG - Intronic
1073713566 10:106074789-106074811 CTGGTACTGCAGATTTAGAAGGG - Intergenic
1074981082 10:118620367-118620389 CTGGCTCTGCAGACCTTGAGGGG - Intergenic
1077742471 11:4861936-4861958 TTGGTGCTGCAGAGGTAGGTAGG - Intronic
1079105420 11:17569139-17569161 TTGGTTCTGGAGAGATAGAAAGG - Exonic
1081626683 11:44660065-44660087 CTGATTCCCCAGAGCTAGAAGGG - Intergenic
1094538946 12:31346994-31347016 CTGGCTCTCCAGATCCAGATTGG + Intergenic
1095091786 12:38114281-38114303 CTGATTCTGCAAAACCAGATGGG + Intergenic
1095804021 12:46298386-46298408 CTGATTCTGCAGGCCTAGAGTGG - Intergenic
1102807663 12:115796019-115796041 CTGGTTCAGCAGACCTGGGTTGG + Intergenic
1104054541 12:125219515-125219537 CTGGATCCCCAGAGCTGGATCGG + Intronic
1104217298 12:126746811-126746833 CTGCCTCTGCAGTGCTAGGTGGG - Intergenic
1104445373 12:128828821-128828843 CAGGTTCTCCTGAGCTACATGGG - Intergenic
1109032835 13:57215878-57215900 CTGGCTATGCAGAGCTACAAAGG + Intergenic
1111919670 13:94396849-94396871 CTGGGGCTCCAGAGCTAGACTGG + Intronic
1113842358 13:113367344-113367366 CTGGTGCTGCAGAGCTGGCTGGG + Intergenic
1117739176 14:58798331-58798353 ATGGTTATGAAGAGCTAGGTTGG + Intergenic
1118389163 14:65281832-65281854 CACGTTCTGCAGGGCAAGATGGG - Intergenic
1120453041 14:84695477-84695499 TTTGTTCTTCAGAGCTTGATTGG + Intergenic
1128236421 15:66070600-66070622 CCAAATCTGCAGAGCTAGATAGG + Intronic
1129177632 15:73851681-73851703 CTCTTTGTGCAGAGCAAGATGGG - Intergenic
1129341907 15:74891713-74891735 CTGGCTTTGCAGAGCTAAATTGG - Intronic
1130161758 15:81408250-81408272 CTGGTTCTGGGGAGCAAGAGAGG + Intergenic
1132338248 15:101062557-101062579 CTGGTCCTGCAGAGGCAGACAGG - Exonic
1143669570 17:8387168-8387190 CTGTTTCTGAAAAGCTAGGTAGG + Intergenic
1144260965 17:13520536-13520558 CTGGTTCTACAGACATAGACTGG - Intronic
1146727095 17:35165264-35165286 GTGGCTTTGCAGAGCTAGACAGG + Intronic
1149382408 17:56107197-56107219 CTGGGGCTGCAGAGCTTGAAGGG + Intergenic
1151954840 17:77375005-77375027 CTGGGTCTGCAGAGCTGGGAGGG + Intronic
1156953109 18:42929301-42929323 CTGATACTGCAGATCTAGTTTGG - Intronic
1157524012 18:48364954-48364976 CTGATTCAGCAGGGCTAGAGTGG + Intronic
1159988542 18:74874611-74874633 CTGGAAATGCAGAGCTAGCTGGG - Intronic
1161587283 19:5112525-5112547 CTGTTTCTGCAGAGCGTGGTGGG - Intronic
1163345208 19:16736910-16736932 CTCTTTCTGCAGAGCTGAATGGG + Intronic
1164716437 19:30394014-30394036 CAGAGTCTGCAGGGCTAGATGGG + Intronic
1165143273 19:33715416-33715438 CTGTTTCTGAACAGATAGATAGG + Intronic
1168350162 19:55671006-55671028 CTGGCTCTGCAGGGCCAGATCGG + Intronic
926149153 2:10415160-10415182 CTGGTTCTGCAGACTTGGAGAGG + Intronic
926867575 2:17376335-17376357 CTGGTTCTGCAGACATTTATTGG + Intergenic
927446604 2:23167733-23167755 CTGGTACTGCAAAGCCACATGGG + Intergenic
927718839 2:25370103-25370125 CTGGCTCTGCAGGGCAGGATTGG - Intergenic
928201519 2:29250460-29250482 CTGGTTCTGCAGGTCTGGAGTGG - Intronic
932292543 2:70594704-70594726 CTGGGGCTGGAGAGTTAGATGGG + Intergenic
932572279 2:72944337-72944359 CTGGTTCTGCAGCTCTGGAATGG + Exonic
937871347 2:126788376-126788398 CAGCTTCTGCAGAGCTGCATTGG + Intergenic
940737714 2:157472143-157472165 ATTGTTCTTCAGAGCTTGATTGG - Intronic
942102840 2:172603059-172603081 CTGGTTCAGCAGATCTGGAGTGG + Intronic
942153902 2:173107226-173107248 CTTGCTCTGCAGAGCTTGGTGGG - Intronic
942610981 2:177742328-177742350 GGGGTTCCGTAGAGCTAGATGGG - Intronic
943670402 2:190654195-190654217 CTTGTTCTGCAGAGCCAGGCAGG + Intronic
944146656 2:196514075-196514097 CTGGGTCTGCAGCCCTTGATGGG - Intronic
948331200 2:237167119-237167141 CTGGTTCTGCAGATCTTTATAGG - Intergenic
1173252448 20:41371414-41371436 CTGCTTCTGCCTAGCTGGATGGG - Intergenic
1174237307 20:49104485-49104507 CTTGGTCTCCAGAGCTTGATGGG - Intergenic
1174570062 20:51495042-51495064 CTGGCTCTGCTGAGCTGGGTTGG - Intronic
1175669820 20:60892555-60892577 CTGGTTCTGCAGAGAAGGTTGGG - Intergenic
1175841305 20:62029437-62029459 CTGGTGCTGCAGAGCTAGCAGGG - Intronic
1177726867 21:24980892-24980914 CTGTTACTGCAGAGATAGGTTGG + Intergenic
1179633109 21:42690847-42690869 CTGGTTCTGCAGAGCTGGGAAGG - Intronic
1182956249 22:34429448-34429470 GTGGTTTTGGAGAGCTAGGTAGG - Intergenic
1183305256 22:37079608-37079630 CTGGGGCTGCAGAGCTGAATTGG + Intronic
1183475404 22:38033468-38033490 CTGGTTCTGTAGGACCAGATGGG + Intronic
1183964176 22:41431453-41431475 CTGGTTCTGAAGAGGTGGACGGG - Intergenic
949426483 3:3922690-3922712 ATGGATGTGTAGAGCTAGATGGG - Intronic
952596398 3:35023748-35023770 CTGTATCTGCAGGGCAAGATAGG + Intergenic
952984157 3:38762737-38762759 CTGGCTCTGCAGGGAAAGATAGG - Intronic
955112124 3:55959693-55959715 CTGGCTCACCAGACCTAGATGGG - Intronic
955406339 3:58627902-58627924 CTCATACTGCAGAGCTAAATGGG + Intergenic
957009970 3:74993131-74993153 CTGGATTTACAGAGCTAGAAAGG - Intergenic
959155490 3:102662080-102662102 CTGGTTCTGGAGTGCTATAGGGG - Intergenic
960846067 3:122005546-122005568 CTGATTCTGCAGGTCTAGAGTGG + Intronic
961980122 3:131068309-131068331 CTGGTTCAGCAGCTCTAGAGTGG - Intronic
964514058 3:157488001-157488023 CTAGTTCTGGAGAGCTAGTCAGG + Intronic
969170167 4:5355940-5355962 CTCATTCTGCTGAGCTAGTTAGG + Intronic
969183392 4:5458636-5458658 CTGGTTCTTGAGAGCTTGTTTGG + Intronic
969966033 4:10996472-10996494 CTGGTACTGCAGAGAGAGCTGGG + Intergenic
970541280 4:17082365-17082387 CTGGTTTTGCGGAGCCAGCTGGG - Intergenic
975883226 4:78936185-78936207 ATGGTTCTCCAGATGTAGATAGG + Intronic
976089576 4:81442170-81442192 CTGGGTCTGTAAAGATAGATGGG + Intronic
976680050 4:87746059-87746081 TTGGGTCTGCAGTGCTGGATTGG + Intergenic
978155314 4:105483288-105483310 GTGGTTAAGCAGAGCTAAATAGG - Intergenic
980859561 4:138482826-138482848 CTGGCTCTGCAGAGGTAGAGAGG - Intergenic
982206240 4:152999184-152999206 CTGGTTCTCCAGGGCTAAACTGG - Intergenic
982831445 4:160066058-160066080 CTGGTTCTGCAGAATGAGTTGGG + Intergenic
984980542 4:185276720-185276742 CTGGTCCAGCATTGCTAGATGGG - Intronic
986483634 5:8213873-8213895 CTGGTTCTGTATAGTTAGAGGGG + Intergenic
995429503 5:112058513-112058535 CTGTTTCAGCAGAGCTGGGTGGG - Intergenic
995735704 5:115297180-115297202 CTGGTTCTGTGGAGCAAGCTGGG - Intergenic
999084212 5:148872806-148872828 CTGGAGCTTCAGAGATAGATGGG - Intergenic
999315179 5:150579069-150579091 CGCGTTCTGCAGAGCCAGAGGGG + Intergenic
999609884 5:153357603-153357625 GTAGTTCTGCAGATCTTGATTGG - Intergenic
1001746841 5:174098864-174098886 CTAGTTCTCCAGCGCTACATTGG - Intronic
1003508529 6:6759869-6759891 CTGCTTCTGTAGAGCTTGCTGGG + Intergenic
1009992848 6:70864993-70865015 CTTCTTCAGCAGAGCTAGGTGGG + Intronic
1012937016 6:105378945-105378967 ATGGTTCTGCAGAGTGGGATTGG - Intronic
1013040851 6:106431861-106431883 CTGGTTCTGTGAAGCTAGAGTGG - Intergenic
1013618652 6:111868220-111868242 CTAGTTTTGCAGAGCTATAAAGG - Intronic
1015999568 6:139029213-139029235 CCAGTTCTGCAGAGCTGGGTGGG + Intronic
1018020155 6:159755082-159755104 CTGCTGCTGCAGAACTAGAATGG - Exonic
1018093771 6:160367156-160367178 ATGGTTCTGCAGGGCTAGGGAGG + Intronic
1019546623 7:1580617-1580639 CTGGCTCTGCAGAGGTAGCCAGG + Intergenic
1022041267 7:26583761-26583783 CTGATTCTGCAGACCTAGTCTGG + Intergenic
1022177050 7:27881243-27881265 TTGGTTCTGAAGGGCTAGATGGG - Intronic
1022301662 7:29107655-29107677 CTGATTCTGCAGATCTGGAGAGG - Intronic
1022826225 7:34017106-34017128 CTGGTTCTGTAGAGTGAGTTAGG + Intronic
1026114087 7:67481585-67481607 GTGGTTCTGCATAGTTACATTGG + Intergenic
1026585489 7:71652852-71652874 TTGGGTTTGCAGAGCCAGATGGG - Intronic
1027251112 7:76399377-76399399 CTGATTCTGCAGGTCTGGATGGG - Intronic
1030356273 7:108546430-108546452 CTGGTTCTTCAGTGATACATAGG + Intronic
1031723125 7:125202056-125202078 TTGGTTCTGAAGAGCTTGCTGGG - Intergenic
1032381543 7:131488606-131488628 CTGGTTCTGCAGAGCTCTTCTGG - Exonic
1035161341 7:156952205-156952227 CTGGGTCTGAAGAGCTACACAGG + Intronic
1035374490 7:158398451-158398473 CTGTTTCTGCATTGCTAGAATGG + Intronic
1036430173 8:8682362-8682384 CTGGTTCTGCAGAGATGGTCTGG + Intergenic
1037205855 8:16319651-16319673 ATAGTTCTGCAGGGCTAGGTAGG - Intronic
1039256627 8:35726016-35726038 GTGGTCCTGAAGAGCTAGCTTGG + Intronic
1039419156 8:37421192-37421214 GGGCTTCTGCAGAGCCAGATGGG - Intergenic
1043518040 8:81014450-81014472 CCAGTGCTGCAGAGCAAGATGGG + Intronic
1048012499 8:130469511-130469533 CTGGTTTTGCAAAGTTTGATGGG + Intergenic
1048606716 8:135976006-135976028 CGGGTTCTGAAAAGCTATATAGG - Intergenic
1050705991 9:8398327-8398349 TTGCTTCTGCAGAGCTTGCTCGG - Intronic
1051101770 9:13530268-13530290 CTAGGTCTGTGGAGCTAGATTGG - Intergenic
1051367765 9:16333356-16333378 CTGGTCCTGCAGTGCTACAGAGG - Intergenic
1053346702 9:37383472-37383494 CTGGTTATCCAGAGCTACCTAGG + Intergenic
1056716670 9:89037077-89037099 CTGCTTCTGCAGAGACAGAAAGG + Intronic
1058110376 9:101026436-101026458 CAGGTTATGCAGAGCTTGTTAGG + Intergenic
1059670812 9:116490586-116490608 ATGGTTCTGCATGGCTAGAGGGG + Intronic
1061510281 9:131056912-131056934 CTGGACCTGCAGAGCGAGAAGGG - Exonic
1189358819 X:40332531-40332553 CTGGTTTTGCAGAGGTTGAGTGG - Intergenic
1195317991 X:103697333-103697355 CTGGCACAGCAGAGCTAGAAGGG - Intergenic
1196153545 X:112402070-112402092 TTGGTTCTTGAGAGATAGATAGG - Intergenic
1196685650 X:118508228-118508250 CTGGCTCTGCAGAGGTACCTGGG + Intronic
1199654446 X:149980789-149980811 CTGGTTCAGCAGGCCTAGAGTGG - Intergenic