ID: 922513352

View in Genome Browser
Species Human (GRCh38)
Location 1:226187291-226187313
Sequence AATTTGTGGGGACCCTCATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922513348_922513352 6 Left 922513348 1:226187262-226187284 CCTGGTTTTGCAGGAAGCGCAGC 0: 1
1: 0
2: 0
3: 14
4: 111
Right 922513352 1:226187291-226187313 AATTTGTGGGGACCCTCATTAGG 0: 1
1: 0
2: 0
3: 8
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922513352 Original CRISPR AATTTGTGGGGACCCTCATT AGG Intergenic
905507689 1:38493194-38493216 AATGTCTGGGGACCCTCAGTAGG - Intergenic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
910469273 1:87534281-87534303 AATTTCTGAGGACACTAATTAGG + Intergenic
911470491 1:98312373-98312395 AAATCGGGGGGAACCTCATTGGG + Intergenic
914895556 1:151668486-151668508 AGTTTGTGAGGAAACTCATTAGG - Exonic
916663995 1:166948790-166948812 AATCTGAGGGAACCCTCTTTAGG - Intronic
922513352 1:226187291-226187313 AATTTGTGGGGACCCTCATTAGG + Intergenic
923346089 1:233053954-233053976 AGGTTGTGGGGAACATCATTTGG - Intronic
923794515 1:237141427-237141449 AATTTGGGGGACGCCTCATTAGG - Intronic
1069106990 10:64395092-64395114 AATTTGTGTGCAGCCTCTTTAGG - Intergenic
1080524360 11:33099794-33099816 AATTTTTGAGGAGCCTAATTTGG - Intronic
1080784829 11:35465423-35465445 AATTTGTTGGTATCCTCATGAGG + Intronic
1089394668 11:118128735-118128757 AATTGGAGGGCTCCCTCATTTGG - Intergenic
1093689613 12:22095135-22095157 CATTTATGGGGAAACTCATTTGG + Intronic
1102045915 12:109830170-109830192 CATTTGTCTGGACCCTCATTGGG - Intronic
1103791857 12:123477797-123477819 TCTTTGTGGGCACCCTCTTTGGG - Intronic
1105800691 13:23900938-23900960 AATGTGTGTGGACCATCACTTGG + Intronic
1111926376 13:94467826-94467848 CATTTTTGGGGTCCTTCATTGGG - Intronic
1112881583 13:104113055-104113077 AATTTTTAGGGACACTCATGCGG + Intergenic
1114898680 14:27027865-27027887 AATTTGTGTTGAGCCTCATGTGG + Intergenic
1114919735 14:27311728-27311750 TGTTTGTGGGGACCCTGGTTGGG + Intergenic
1115751280 14:36493089-36493111 AATTGGAGGGGACTCTGATTAGG + Intronic
1121734765 14:96210602-96210624 AATTTGTGGGGGCAGTCATGGGG + Intronic
1122855390 14:104557513-104557535 ATTTTGTGGGTCCCTTCATTTGG - Intronic
1124343780 15:28907714-28907736 AATCTGTGGGGACTCTCCCTGGG + Intronic
1129703976 15:77784107-77784129 AATCTGTCAGGACCCTCCTTTGG + Intronic
1138269727 16:55686564-55686586 AATTTGGGAGAATCCTCATTAGG + Intronic
1138468103 16:57208855-57208877 GATTTGTGGGTACCTTTATTTGG - Intronic
1156057401 18:33024460-33024482 AATATGGGTGGACCCTAATTCGG - Intronic
1156844008 18:41642323-41642345 AAATAGTGGGGACCCTGAATAGG + Intergenic
1158497726 18:57971473-57971495 ATTTTGTAGGGACCTTTATTTGG + Intergenic
1159077319 18:63695721-63695743 AATTTGCTGGGACCCTGATTGGG + Intronic
1165375615 19:35439667-35439689 CTTTTGGGGGGACCATCATTTGG + Intergenic
930511867 2:52356033-52356055 AATTTGTTTGGAGCCTCATTAGG + Intergenic
932574190 2:72953940-72953962 AAAATGTGGGTACCCTCAGTGGG - Intronic
932658917 2:73635320-73635342 ATTTTGGGGTGACTCTCATTGGG - Intergenic
936539222 2:113336667-113336689 CATTTGTGGAGACCCTCAGGAGG + Intergenic
937252974 2:120535613-120535635 AGTTGGTGGGGAGCCGCATTTGG - Intergenic
937268810 2:120633937-120633959 GATTTGTGGGGACCAACACTGGG - Intergenic
939045741 2:137247686-137247708 AATTGGTAGGAAACCTCATTTGG + Intronic
941225037 2:162838459-162838481 CATTTCTGGGGACCATCATTCGG - Exonic
941606468 2:167603534-167603556 AAGATGAGGGGAACCTCATTAGG + Intergenic
943586412 2:189746205-189746227 AATTTGTGGGGACCACTATATGG - Intronic
1174731217 20:52919791-52919813 ACCTTCTGGGGACCCTCAGTGGG - Intergenic
1184367567 22:44062287-44062309 CAGTCGTGGGGACCCTGATTTGG - Intronic
956546114 3:70405160-70405182 ATTATGTGGTGACCCTTATTTGG - Intergenic
959110372 3:102115745-102115767 ATTTGGAGGAGACCCTCATTAGG - Intronic
962992014 3:140586467-140586489 CATTTGTGGAAACCTTCATTAGG - Intergenic
963893385 3:150660254-150660276 AATTAGAGTGGACCCTCATCAGG - Intronic
971227715 4:24770315-24770337 AGTTTGTGGGGACCCTGAATGGG - Intergenic
978521200 4:109617377-109617399 AATGTGTGGGGAGCCTTATTTGG - Intronic
981890308 4:149728570-149728592 AAAATGTGGGGAGCCACATTGGG + Intergenic
985015132 4:185626001-185626023 AGATTGTGGGGTCCCACATTTGG + Intronic
985586148 5:736292-736314 AATTTGGGGGGTTCCTCGTTAGG - Intronic
987576352 5:19733580-19733602 ACTTTCTGGGCACCCTCATTTGG - Intronic
989774371 5:45185114-45185136 TATTTGTGGGTCCCCACATTCGG - Intergenic
1001150291 5:169221464-169221486 AATCTGTGGGCTCCCTGATTTGG - Intronic
1002881704 6:1258095-1258117 GATTTGTGGGAACCCTGAGTCGG + Intergenic
1002936505 6:1678125-1678147 AAGTTGTGGGGTCCCTCCTAAGG - Intronic
1005087332 6:22020668-22020690 AAATTGTAGGAACCTTCATTGGG + Intergenic
1006422080 6:33941224-33941246 AATTAGTGTGGACCATCATGTGG - Intergenic
1012699969 6:102443382-102443404 AATTTGTGGGGACATTTTTTGGG - Intergenic
1014539602 6:122658637-122658659 TATTAGTGGGGACCCTCTCTGGG + Intronic
1015390572 6:132676995-132677017 CATATTTGGGGACCCACATTTGG - Intergenic
1016135989 6:140543748-140543770 AATTTGTAGGGAAGCACATTTGG + Intergenic
1019728532 7:2616892-2616914 AGCTTGTGGTGACCCTCACTCGG - Intergenic
1026841619 7:73672434-73672456 ACTCCGTGGGGACCGTCATTTGG - Intergenic
1028861033 7:95650553-95650575 ATTTTGAGGGGACACTAATTAGG + Intergenic
1029789765 7:102829923-102829945 AAGATGTGGGGACCATCATCTGG - Intronic
1031862167 7:126993429-126993451 AATTTGTGGAGACTTTTATTTGG - Intronic
1045613647 8:103878979-103879001 AATTTTTGAGGACCCAAATTGGG - Intronic
1048593036 8:135839087-135839109 TAGTTCTGGGGACCATCATTAGG - Intergenic
1048685641 8:136902454-136902476 AATTTTTTGTGACCCTAATTGGG - Intergenic
1050190991 9:3026109-3026131 ATTTTGTGCAGACACTCATTAGG + Intergenic
1050428695 9:5539339-5539361 CATTCATGGGAACCCTCATTGGG - Intronic
1051818198 9:21134132-21134154 ACATTTTGGGGACCCTCACTTGG - Intergenic
1060449169 9:123721089-123721111 AAGTTGTGGGGATCTGCATTGGG - Intronic
1187111813 X:16309704-16309726 AATGTGTGAGGTCCTTCATTAGG - Intergenic
1193601518 X:83512356-83512378 AAATTGTGGGAACCCGCATAGGG + Intergenic
1196555078 X:117076534-117076556 CATTTATGGGTGCCCTCATTTGG - Intergenic
1197569304 X:128129811-128129833 ATTATGTGGTGACCCTCACTAGG - Intergenic
1200125084 X:153809652-153809674 ATTTTGTGGAGACCCACATCAGG - Intronic