ID: 922526537

View in Genome Browser
Species Human (GRCh38)
Location 1:226308796-226308818
Sequence CTTCCCTCCACCTCGGCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 222}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922526529_922526537 -5 Left 922526529 1:226308778-226308800 CCGCGCCCAGGGGCCGCTCTTCC 0: 1
1: 0
2: 0
3: 16
4: 254
Right 922526537 1:226308796-226308818 CTTCCCTCCACCTCGGCTGGGGG 0: 1
1: 0
2: 1
3: 13
4: 222
922526526_922526537 -2 Left 922526526 1:226308775-226308797 CCCCCGCGCCCAGGGGCCGCTCT 0: 1
1: 0
2: 2
3: 18
4: 283
Right 922526537 1:226308796-226308818 CTTCCCTCCACCTCGGCTGGGGG 0: 1
1: 0
2: 1
3: 13
4: 222
922526527_922526537 -3 Left 922526527 1:226308776-226308798 CCCCGCGCCCAGGGGCCGCTCTT 0: 1
1: 0
2: 0
3: 13
4: 125
Right 922526537 1:226308796-226308818 CTTCCCTCCACCTCGGCTGGGGG 0: 1
1: 0
2: 1
3: 13
4: 222
922526530_922526537 -10 Left 922526530 1:226308783-226308805 CCCAGGGGCCGCTCTTCCCTCCA 0: 1
1: 0
2: 2
3: 14
4: 202
Right 922526537 1:226308796-226308818 CTTCCCTCCACCTCGGCTGGGGG 0: 1
1: 0
2: 1
3: 13
4: 222
922526521_922526537 28 Left 922526521 1:226308745-226308767 CCGGGCGAGTGGTGCAGGCGGCG 0: 1
1: 0
2: 1
3: 8
4: 117
Right 922526537 1:226308796-226308818 CTTCCCTCCACCTCGGCTGGGGG 0: 1
1: 0
2: 1
3: 13
4: 222
922526528_922526537 -4 Left 922526528 1:226308777-226308799 CCCGCGCCCAGGGGCCGCTCTTC 0: 1
1: 0
2: 0
3: 11
4: 175
Right 922526537 1:226308796-226308818 CTTCCCTCCACCTCGGCTGGGGG 0: 1
1: 0
2: 1
3: 13
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922526537 Original CRISPR CTTCCCTCCACCTCGGCTGG GGG Intronic
900179582 1:1305343-1305365 CTGACCTCTACCTCAGCTGGAGG + Intronic
900435318 1:2628347-2628369 CATCCCTCCACCCCTGCGGGAGG - Intronic
900580239 1:3405142-3405164 CTTCCTTCCACACCGGCGGGAGG - Intronic
900714132 1:4133234-4133256 CTTCCCTCCCTCCCGGCCGGAGG - Intergenic
901197895 1:7450444-7450466 CCTCCACCCACCTCTGCTGGAGG + Intronic
902394666 1:16126096-16126118 CTGCCTTCCCCCTCGGCTGCTGG - Intronic
908416105 1:63914848-63914870 CTTCCATGCACCTTGGCTGATGG + Intronic
910859683 1:91731500-91731522 CCTCCCTCCACATCTGCTGAGGG + Intronic
911520832 1:98927826-98927848 CTTCCCTTCCCCTAGGTTGGTGG + Intronic
912984962 1:114418557-114418579 CTTTCCTCCTCCTAGCCTGGTGG - Intronic
913070034 1:115290277-115290299 CTGCTCTCCACCTCTGCTGGTGG + Intronic
915165709 1:153946675-153946697 CACCCCTCCTCCTCGGCCGGCGG + Exonic
916442689 1:164843007-164843029 CTTCCCTCTACCTCGACTGTGGG - Intronic
917153199 1:171966294-171966316 CTTCCCTCTCCCTCAGCTGCAGG + Intronic
920094621 1:203478031-203478053 CTTCCCTCCAGCCTGGCTAGAGG - Intronic
922336362 1:224621628-224621650 CTTCCTTCCACTTCAGCTGTGGG - Intronic
922526537 1:226308796-226308818 CTTCCCTCCACCTCGGCTGGGGG + Intronic
1063407658 10:5812914-5812936 CTCCCCTCCGCTTCCGCTGGGGG + Intronic
1069889626 10:71644869-71644891 CTCCCCTCCAACTGGGCAGGCGG - Intronic
1069917075 10:71793754-71793776 CTTCTCTCCCCCTCCTCTGGAGG + Intronic
1072682572 10:97517500-97517522 CTTCCCCACACCTCGGCAAGGGG - Intronic
1073069165 10:100782515-100782537 CTTCCCTCAGCCTAGGCTGGGGG - Intronic
1074357613 10:112799871-112799893 CACCCCTCCACCTGGGCTGGGGG + Intronic
1076002050 10:126920045-126920067 ACTCCCTCCACCCCGGCTGTGGG + Intronic
1076426373 10:130370214-130370236 CTCCTCTCCACCTCTGCAGGGGG - Intergenic
1077247344 11:1546192-1546214 CCGCCCTGCACCTGGGCTGGGGG + Intergenic
1079164665 11:18028642-18028664 CTTTCCTCTACCTTGGCTGCAGG + Intronic
1079871292 11:25801439-25801461 CTTCCCTGCTCCTCAGCTTGCGG - Intergenic
1081904545 11:46659474-46659496 CTTCCCCCTACCTGGGATGGTGG - Exonic
1084585052 11:70054458-70054480 CTCCCCACCACCTCAGCTGCTGG + Intergenic
1084888273 11:72224308-72224330 CTTCCCTCCACCCAAGCGGGCGG - Intronic
1085301641 11:75462310-75462332 CTCCCCTCCACCTCTTCAGGAGG + Intronic
1089462550 11:118661597-118661619 CTCCTCCCCACCTAGGCTGGAGG + Intronic
1089901681 11:121993056-121993078 CATGGCTCCACCTGGGCTGGAGG - Intergenic
1090667782 11:128926188-128926210 CCTCCTTCCAGCTCGGCTGCAGG - Intergenic
1090731906 11:129579727-129579749 CTGCCTCCCACCTTGGCTGGTGG - Intergenic
1091168415 11:133500563-133500585 CTTCCCACCACCTCCCCTGCAGG + Intronic
1092030178 12:5277369-5277391 GTGCCCTCTAGCTCGGCTGGGGG - Intergenic
1095986053 12:48000559-48000581 CTTCTCTGCTCCTGGGCTGGTGG - Intronic
1096041767 12:48523543-48523565 CTTCTCTCCAACTTGGCTGCAGG - Intronic
1096676964 12:53231352-53231374 GTGCCCCCCACCTTGGCTGGAGG + Intronic
1096807337 12:54148756-54148778 CTTCCCTCCACCTTGGCTGCTGG + Intergenic
1096816892 12:54207465-54207487 CTTCCCCCCACCTCCACTGCTGG - Intergenic
1098731426 12:74040372-74040394 CTTCCCTGCTCCTCAGCTTGTGG + Intergenic
1101430639 12:104624040-104624062 CTTCCCTCCATCAAGGCTGCAGG - Intronic
1102755445 12:115335782-115335804 CTTCCCTCCTTCTGGGCTGCTGG - Intergenic
1103428723 12:120862802-120862824 CTTCCCTCAACCTCTGCAGAGGG - Intronic
1107862052 13:44670434-44670456 CTTTCCTGCTCCTGGGCTGGTGG - Intergenic
1108614658 13:52120193-52120215 CTTCCCTACATCTCAGCTGAAGG + Intronic
1111097960 13:83539086-83539108 CTTTGCCCCACCTTGGCTGGTGG - Intergenic
1112360092 13:98709469-98709491 CTTCCCGCAACCTCGCCTAGAGG - Intronic
1112388683 13:98963160-98963182 CTTCCCTACACCTCCCATGGGGG + Intronic
1113349499 13:109514285-109514307 CATCCCTCCACCTCACCGGGAGG + Intergenic
1113692910 13:112324302-112324324 CTTACCTCCAGCTCTGCAGGAGG - Intergenic
1119514742 14:75239341-75239363 CCTCCCCCCACCATGGCTGGGGG + Intronic
1121199599 14:92106368-92106390 CCTCCCGCCTCCTCGGCTCGAGG - Intronic
1121495363 14:94388432-94388454 CTGCCCTGCACCTCAGCAGGCGG + Intronic
1121582932 14:95044531-95044553 CCTCCCTCCTCCTTGGCTGGAGG - Intergenic
1123087044 14:105721532-105721554 CCTCCCACCACCTCTCCTGGGGG + Intergenic
1127654867 15:61046378-61046400 CTCCCCACCACCTCTCCTGGCGG - Intronic
1128029410 15:64466497-64466519 CTTCACTCCACTTGGGCTGTGGG - Intronic
1128355352 15:66922708-66922730 GATCCCTCCAGCTGGGCTGGAGG + Intergenic
1128387890 15:67163656-67163678 CTTCCCTGAACCTCTGCTGCTGG + Intronic
1128391423 15:67185312-67185334 CTTCTCTCTACCTGGGCTGCTGG - Intronic
1131097514 15:89665866-89665888 CGGCGCTCGACCTCGGCTGGTGG + Exonic
1131316145 15:91339526-91339548 CTTCCCTCCACATCTCCAGGAGG - Intergenic
1132273293 15:100544731-100544753 CATCCCTCGACCCGGGCTGGAGG - Intronic
1132679970 16:1135821-1135843 CATCCCAGCACCTCGGCAGGTGG - Intergenic
1132772779 16:1573707-1573729 CTCCACTCCAGCTCTGCTGGTGG + Intronic
1132953445 16:2578117-2578139 CTGCCCTCCACCCCGACGGGGGG - Intronic
1133056092 16:3146074-3146096 CTTCCCCTCACCTGGGCTGTAGG - Exonic
1134107567 16:11494778-11494800 TTACCCACCACCTCGGGTGGGGG - Intronic
1136461727 16:30415415-30415437 CTTGCCGTCACCTAGGCTGGAGG + Intronic
1138695021 16:58804911-58804933 CTCCCCTCCCCCTCAGCTAGAGG + Intergenic
1139168685 16:64603287-64603309 CTTCACTCTACCTTTGCTGGTGG - Intergenic
1141417532 16:83887950-83887972 CTTCTCCCCACCTCAGCTGAAGG + Intergenic
1141464206 16:84195816-84195838 CTGCCCCCCACCTCGGAAGGTGG + Exonic
1142497269 17:312872-312894 CTTCCCTCCTCCCTGGCTGCAGG - Intronic
1142847909 17:2691005-2691027 CTTTCCTCCCCCTGCGCTGGAGG - Intronic
1143528305 17:7484878-7484900 CTTCCCCCCTCCTCCCCTGGCGG + Intronic
1144269259 17:13601334-13601356 CTTCCCGCTCCCTCGACTGGAGG - Exonic
1144835844 17:18156357-18156379 CTTCCCTCCACCCAGGCTGAGGG + Intronic
1145034772 17:19533547-19533569 CGGCTCTCCACCTCCGCTGGGGG - Intronic
1147363492 17:39945564-39945586 CTTCACTCCCCCTCAGCTGGGGG - Intergenic
1147577225 17:41609813-41609835 CTCCCCTGCTCCTCTGCTGGTGG - Exonic
1148105489 17:45116595-45116617 CCTCCCTCCACCCAGGCTAGGGG + Intronic
1148397799 17:47324039-47324061 CCTCCCTTCCTCTCGGCTGGAGG - Exonic
1148862963 17:50614123-50614145 CTTCCTTCAGCCTCGGGTGGGGG + Intronic
1151813605 17:76459871-76459893 CTTGCCTAGACCTCGGCTGTAGG + Intronic
1151911761 17:77088227-77088249 CTTCCTGCCACCTGGGGTGGTGG + Intronic
1151976028 17:77483924-77483946 CTTGCCTGCACCTCTGCAGGTGG - Intronic
1152012583 17:77727413-77727435 CCTGCCTCCACCTTGGCTGGGGG + Intergenic
1152109818 17:78351769-78351791 CTTCCCTCTCCCTGAGCTGGAGG - Intergenic
1153415720 18:4843861-4843883 CTCACCTCCCCCTAGGCTGGTGG - Intergenic
1153523983 18:5977846-5977868 CTTACCTCCTCCTGGGCTGAGGG - Intronic
1154016912 18:10626993-10627015 CTTCCCTCCACCACAGGTTGAGG + Intergenic
1154188595 18:12208651-12208673 CTTCCCTCCACCACAGGTTGAGG - Intergenic
1158636157 18:59160096-59160118 CTTCCCTCAGCCTCAGATGGAGG + Intergenic
1160071856 18:75635925-75635947 CTTCCCTCCTCCTCGGTTCCAGG - Intergenic
1160685107 19:430948-430970 CTTCTCTCCACCTCGGAAGGTGG + Intronic
1161871118 19:6870756-6870778 CTTCCCTCCACCCCGGCCCTAGG + Intergenic
1161984533 19:7646373-7646395 CAGCCCTCCGCATCGGCTGGCGG + Intronic
1162404734 19:10467025-10467047 CTTGACTCCTCCTCGGGTGGCGG - Exonic
1162421663 19:10568947-10568969 CCTCCCTCCTCCTCGCCGGGCGG + Exonic
1163250912 19:16125763-16125785 CATCCCTCCAGCTAGGCTGTTGG + Intronic
1163750346 19:19073296-19073318 CTTCCCTGCAACCAGGCTGGGGG - Intronic
1164437215 19:28240864-28240886 CATCCCTCCACCTTGCCTGTGGG - Intergenic
1167516715 19:49927833-49927855 CGGACATCCACCTCGGCTGGTGG + Exonic
925497927 2:4472985-4473007 CTTCCCTGCTCCTCAGCTTGGGG - Intergenic
927155408 2:20218344-20218366 CTGCCTCCCACCTCTGCTGGTGG - Intronic
927928068 2:27026787-27026809 CTTCCCTTCCCCATGGCTGGGGG + Exonic
930686446 2:54313384-54313406 CTGCCCCCCACCTCAGCTGACGG + Intergenic
932305913 2:70704276-70704298 CTCCCCTCCACCTCTGCTCCTGG + Intronic
932594902 2:73087754-73087776 CTTCCCTCCAGCTCAGGGGGTGG + Intronic
932625224 2:73291927-73291949 CTTCCCTAAACCTCTGGTGGCGG - Exonic
933741634 2:85538759-85538781 ATTCCCGCCGCCTCCGCTGGGGG + Intergenic
934887481 2:98037731-98037753 CTGCCCTCCACTCCTGCTGGGGG - Intergenic
943290072 2:186059331-186059353 CTGCCTTCCACCCCGGCTGATGG + Intergenic
944270933 2:197785256-197785278 CTTCCCGCCACTGCTGCTGGCGG - Intronic
944310287 2:198225498-198225520 CTGCCCTCCACTAAGGCTGGGGG + Intronic
946432970 2:219635358-219635380 CGGCCCTCCACCTCGGACGGGGG - Exonic
948856152 2:240731648-240731670 CTCCCCTCCACCTCTGCTCATGG + Intronic
948948917 2:241236407-241236429 CTTCCCTTCACCAAGGCTCGGGG - Intronic
1169199187 20:3699417-3699439 CCTTCCACCACCTCGGCTGCCGG + Exonic
1172606860 20:36219870-36219892 CTCGCCTGCAGCTCGGCTGGGGG - Intronic
1173674968 20:44825635-44825657 CTACTGTCCACCTCAGCTGGGGG - Intergenic
1173849265 20:46207530-46207552 CTCCCTTCCACCCGGGCTGGTGG - Intronic
1173915720 20:46707554-46707576 CTTCCCTCAGCCTAGCCTGGAGG - Intergenic
1174870333 20:54175093-54175115 CTCCCCTCCTCCCTGGCTGGTGG - Intergenic
1175676067 20:60947945-60947967 CTTCCCTCCCTCTAGACTGGAGG - Intergenic
1178136578 21:29634694-29634716 CTTTCCTGAACCTCTGCTGGAGG - Intronic
1179327873 21:40367291-40367313 CTGCCTTCCACCTCTGCTGCTGG + Intronic
1180014240 21:45072522-45072544 CTTCCCTCCATCTCCCCAGGAGG - Intergenic
1181102598 22:20551351-20551373 CTTCCCGCCCCCTCGCCTGCTGG - Intronic
1181329296 22:22076728-22076750 CTTTCCTGCACCTGGGCTGAAGG + Intergenic
1181889770 22:26052257-26052279 ATTCCCTCCAACTTGGCTGCAGG + Intergenic
1182423603 22:30260391-30260413 GTTTCCTCCACCTCAGCTGCTGG - Intergenic
1183308998 22:37099166-37099188 CATCCCTACATCTCAGCTGGAGG - Intronic
1183683965 22:39350934-39350956 CTGCCCCCCAGCTAGGCTGGAGG - Intronic
1184864750 22:47195884-47195906 CTGCCCTCCCCCTGGGCTGCAGG + Intergenic
1184994414 22:48194935-48194957 CTTCCCTCTGCCTGGGCTGACGG + Intergenic
1185409210 22:50673847-50673869 CTTCCCACCGCCTCGGCGAGAGG - Intergenic
949344604 3:3065153-3065175 CTGCCCTCCACCTCCGCGGCCGG - Intergenic
950507842 3:13406769-13406791 CTTCTCTGCACCTCAGCAGGTGG + Intronic
950799157 3:15535320-15535342 CTTCCCTACTCCTGTGCTGGTGG + Intergenic
953157274 3:40386722-40386744 TTTCCCTCCACCTAGGGTTGGGG + Intergenic
953186862 3:40646127-40646149 CTGGCCTCCTCCTGGGCTGGTGG - Intergenic
953215137 3:40911025-40911047 CTTGCCTCCTCCTCTTCTGGTGG + Intergenic
954130968 3:48560814-48560836 GGTCCCTCCCCCTGGGCTGGAGG + Intronic
954334755 3:49909756-49909778 CTTCCCAGCCCCTCTGCTGGGGG + Intronic
956696343 3:71922279-71922301 CCTTCCTCCACCTGGGCTCGGGG - Intergenic
959784811 3:110283245-110283267 CTTCCCTCTACCCCTGCTGCAGG + Intergenic
960994781 3:123333585-123333607 CTGCCTTCCTCCTGGGCTGGGGG - Intronic
961364591 3:126391147-126391169 CTTCCCTGCAGCTCTGGTGGAGG - Intergenic
962232398 3:133676910-133676932 CTTCCCTCCTTCTTGGCTGCTGG + Intergenic
962629685 3:137263669-137263691 CTTCCCTACACCTAAGTTGGAGG + Intergenic
962903592 3:139781545-139781567 CATCCCTCCACCACTGCTGCAGG - Intergenic
963106708 3:141653713-141653735 CTTCCCTGGAACTCTGCTGGGGG + Intergenic
969188606 4:5498986-5499008 CTGGCCTCCCCCTCGGCTGTCGG - Exonic
969291073 4:6240345-6240367 CAGCCCTCCTCCCCGGCTGGGGG + Intergenic
969432174 4:7161741-7161763 CTGCCCTCCCCATGGGCTGGGGG + Intergenic
970951751 4:21764826-21764848 CTCCCCTCCAGCTAGTCTGGGGG - Intronic
974012759 4:56622870-56622892 TTTACCCCCAACTCGGCTGGTGG + Intergenic
974770334 4:66403614-66403636 CGGCACTCCACCTGGGCTGGTGG - Intergenic
974926554 4:68305963-68305985 CTGCCCACCACCCCTGCTGGTGG + Intergenic
978619401 4:110623233-110623255 AGTCCCTCCACCGCGGCTCGGGG - Intronic
981429860 4:144646044-144646066 CTTCCCTCCACCCTGGGCGGGGG + Exonic
982717514 4:158824529-158824551 CTTTCCCCCACCTCTGCTGCTGG + Intronic
984891964 4:184502294-184502316 CCTCCCTCCACATCAGCTGCAGG + Intergenic
985580936 5:694718-694740 CTTCCCTCCTGCTCGGGTGCGGG + Intergenic
985595561 5:786050-786072 CTTCCCTCCTGCTCGGGTGCGGG + Intergenic
985755070 5:1708929-1708951 CTTCCCTCCTCCTCCCCTGCGGG - Intergenic
987103105 5:14610068-14610090 CTTCCCCCCACCGTGGCGGGAGG + Intronic
987416115 5:17663509-17663531 CTTCCCTCCACCGGGGGTGCGGG + Intergenic
988697824 5:33641763-33641785 CTTCTCTCCACATGTGCTGGGGG - Intronic
990006362 5:50947968-50947990 CTCCCCTACACCTAGGCTGTAGG - Intergenic
994504307 5:100621870-100621892 CTTCCTTTCACCAAGGCTGGAGG - Intergenic
997855776 5:137371277-137371299 CTTCCCTCCACTTAAACTGGTGG + Intronic
997950986 5:138242273-138242295 CTCCCCTCCACCACGGCAGCCGG - Intergenic
999246858 5:150159727-150159749 CTTCCCTCCAGCCCTGATGGTGG - Intergenic
1000298560 5:159934404-159934426 CTTCCCACCCCCTCGTCTTGAGG + Intronic
1002855645 6:1035699-1035721 CTTGCCACCCCCTCGCCTGGAGG - Intergenic
1003139282 6:3457149-3457171 GTTACCTCCACCTCGGCGGGGGG - Intergenic
1004970774 6:20907765-20907787 TTCCCATCCACCTCGGGTGGTGG - Intronic
1005900772 6:30214558-30214580 CTTCACCCCTCCTCCGCTGGGGG + Intergenic
1006317600 6:33299414-33299436 ATTCCCGCCCCCTCGGCAGGGGG + Intergenic
1007226826 6:40321040-40321062 CTTCCCTTCTCCCCTGCTGGTGG - Intergenic
1007450661 6:41938929-41938951 CTTCCCTCTGCCTGAGCTGGGGG - Intronic
1007655149 6:43447234-43447256 CTTCTCTCCCCCAGGGCTGGTGG + Exonic
1007711324 6:43826113-43826135 CGGCCCTCCATCTCGGCTGAAGG - Intergenic
1013734206 6:113206672-113206694 CTTCCCTCCACCTTCGCTTTAGG - Intergenic
1017775620 6:157678790-157678812 GTTCCCTCCACCTATTCTGGAGG + Intergenic
1018569538 6:165194643-165194665 CTTCCCTGCTCCTCAGCTTGCGG + Intergenic
1019357146 7:586503-586525 CTTCCCCCCAACAGGGCTGGAGG - Intronic
1019559080 7:1647046-1647068 CTGTCCTCCACCCCGGATGGTGG - Intergenic
1019778649 7:2927011-2927033 CTTTCCTCCTCCCCTGCTGGAGG - Intronic
1023863696 7:44229086-44229108 CCTCACTCCACCTCAGCTTGCGG - Intronic
1029490500 7:100867707-100867729 GTTCCCCCCGCCTCGGCTTGGGG - Intronic
1029519077 7:101048764-101048786 ACTCCCTCCACCCAGGCTGGGGG + Intronic
1029646418 7:101859223-101859245 CCTCCCTGCACCTGAGCTGGGGG + Intronic
1029736417 7:102468137-102468159 CTGCCCTCCACCTGGGCCGACGG - Exonic
1034266450 7:149783385-149783407 CTGCCCTCCACCTGGGCTCTTGG + Intergenic
1034659917 7:152759980-152760002 CTGGCGTCCACCTCGCCTGGAGG + Intronic
1034830755 7:154305458-154305480 CTTCCCACCACCGGGGCAGGTGG - Exonic
1035305657 7:157929689-157929711 CTTCCCTGTCCCTCGGGTGGGGG + Intronic
1035675277 8:1451614-1451636 CTTCCCTCCGCCTCTGTTGCCGG + Intergenic
1037768821 8:21787410-21787432 CTTCCCTCCTCCACCTCTGGGGG - Intronic
1040902237 8:52428833-52428855 CTTCCCTGCCCCAGGGCTGGAGG + Intronic
1041611183 8:59851256-59851278 CTCCACTCCACCTTTGCTGGTGG + Intergenic
1041687916 8:60661127-60661149 CTTCCCTCTTCCTTGGCTGAGGG + Intergenic
1041693057 8:60708528-60708550 CTTCCCTTCACCTGGGATGCAGG + Intronic
1043912169 8:85875697-85875719 CTTCCCACTACCTGGGATGGTGG + Intergenic
1046919753 8:119715672-119715694 CTTCCATCAAACTCAGCTGGTGG + Intergenic
1048982016 8:139707486-139707508 CTTCCCTCCACCTCTGCCCGGGG + Intergenic
1050526835 9:6553674-6553696 CTTCCTTCCTCCTCTGGTGGAGG + Intronic
1050899908 9:10934130-10934152 CTGCCCTCCACTCCTGCTGGTGG - Intergenic
1056317957 9:85409533-85409555 CTTCCCTCAATTTTGGCTGGTGG + Intergenic
1056852013 9:90092978-90093000 CCTCCCTCCTCCTCTGCTGCTGG - Intergenic
1056914225 9:90730662-90730684 CTTCCCTCCCCCAGGTCTGGGGG + Intergenic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1058504687 9:105656011-105656033 CTGCCACCCACCTGGGCTGGGGG - Intergenic
1059123472 9:111662160-111662182 CTCCTCTCTACCTCGGCGGGTGG - Intronic
1059441131 9:114307505-114307527 TTTCCTTCCATCTCGGTTGGAGG + Intronic
1059915147 9:119091218-119091240 CTGCCCTCCTCCTTGGCTGGAGG - Intergenic
1061493138 9:130957170-130957192 CCACCCTCCACCTAGGCTCGGGG - Intergenic
1062170709 9:135133285-135133307 CTTCTCTCCAGCTCGCCTGATGG - Intergenic
1062382160 9:136291705-136291727 CTTGCCTCCAGCCCGGATGGAGG - Intronic
1062424572 9:136500181-136500203 CCTCCCTCAACCTTGGCTGCCGG - Intronic
1062440787 9:136568428-136568450 CTCCCCTCCAGCTGGGGTGGGGG - Intergenic
1190708570 X:53049497-53049519 CATCCCTCCACCAAGGATGGGGG + Intronic
1194284553 X:91993798-91993820 CTTCCCTTCTCCTTGGCTGCAGG + Intronic
1195517562 X:105794755-105794777 CCTCCCTTCACCTAGACTGGAGG - Intergenic
1196442895 X:115730968-115730990 CTTGCCTTCACCTTGGCTTGGGG + Intergenic
1197838086 X:130716459-130716481 CTTTCCTCCACCACAGATGGGGG - Intronic
1199979847 X:152914938-152914960 CTGCCCTCCACATGGCCTGGCGG - Intronic
1200255558 X:154580694-154580716 CTTCCCTCCTCCCCGCCTGCAGG + Intergenic
1200262211 X:154623710-154623732 CTTCCCTCCTCCCCGCCTGCAGG - Intergenic