ID: 922527450 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:226316487-226316509 |
| Sequence | CTCCCTAGTGAAGATTTCTT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 922527450_922527454 | 27 | Left | 922527450 | 1:226316487-226316509 | CCTAAGAAATCTTCACTAGGGAG | No data | ||
| Right | 922527454 | 1:226316537-226316559 | TTCATTCCTCTCATCAAAATGGG | No data | ||||
| 922527450_922527453 | 26 | Left | 922527450 | 1:226316487-226316509 | CCTAAGAAATCTTCACTAGGGAG | No data | ||
| Right | 922527453 | 1:226316536-226316558 | GTTCATTCCTCTCATCAAAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 922527450 | Original CRISPR | CTCCCTAGTGAAGATTTCTT AGG (reversed) | Intergenic | ||