ID: 922527450

View in Genome Browser
Species Human (GRCh38)
Location 1:226316487-226316509
Sequence CTCCCTAGTGAAGATTTCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922527450_922527454 27 Left 922527450 1:226316487-226316509 CCTAAGAAATCTTCACTAGGGAG No data
Right 922527454 1:226316537-226316559 TTCATTCCTCTCATCAAAATGGG No data
922527450_922527453 26 Left 922527450 1:226316487-226316509 CCTAAGAAATCTTCACTAGGGAG No data
Right 922527453 1:226316536-226316558 GTTCATTCCTCTCATCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922527450 Original CRISPR CTCCCTAGTGAAGATTTCTT AGG (reversed) Intergenic