ID: 922532373

View in Genome Browser
Species Human (GRCh38)
Location 1:226354149-226354171
Sequence TGAACTCATGTTTCTGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922532373_922532375 -3 Left 922532373 1:226354149-226354171 CCCTGGGCAGAAACATGAGTTCA No data
Right 922532375 1:226354169-226354191 TCACAGCAAAAAGACAAGCTAGG No data
922532373_922532377 1 Left 922532373 1:226354149-226354171 CCCTGGGCAGAAACATGAGTTCA No data
Right 922532377 1:226354173-226354195 AGCAAAAAGACAAGCTAGGGAGG No data
922532373_922532376 -2 Left 922532373 1:226354149-226354171 CCCTGGGCAGAAACATGAGTTCA No data
Right 922532376 1:226354170-226354192 CACAGCAAAAAGACAAGCTAGGG No data
922532373_922532378 14 Left 922532373 1:226354149-226354171 CCCTGGGCAGAAACATGAGTTCA No data
Right 922532378 1:226354186-226354208 GCTAGGGAGGAAAAGACGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922532373 Original CRISPR TGAACTCATGTTTCTGCCCA GGG (reversed) Intergenic
No off target data available for this crispr