ID: 922532376

View in Genome Browser
Species Human (GRCh38)
Location 1:226354170-226354192
Sequence CACAGCAAAAAGACAAGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922532372_922532376 -1 Left 922532372 1:226354148-226354170 CCCCTGGGCAGAAACATGAGTTC No data
Right 922532376 1:226354170-226354192 CACAGCAAAAAGACAAGCTAGGG No data
922532366_922532376 24 Left 922532366 1:226354123-226354145 CCCCAGTCAAGGAAAGCAGGACC No data
Right 922532376 1:226354170-226354192 CACAGCAAAAAGACAAGCTAGGG No data
922532371_922532376 3 Left 922532371 1:226354144-226354166 CCATCCCCTGGGCAGAAACATGA No data
Right 922532376 1:226354170-226354192 CACAGCAAAAAGACAAGCTAGGG No data
922532368_922532376 22 Left 922532368 1:226354125-226354147 CCAGTCAAGGAAAGCAGGACCAT No data
Right 922532376 1:226354170-226354192 CACAGCAAAAAGACAAGCTAGGG No data
922532374_922532376 -3 Left 922532374 1:226354150-226354172 CCTGGGCAGAAACATGAGTTCAC No data
Right 922532376 1:226354170-226354192 CACAGCAAAAAGACAAGCTAGGG No data
922532373_922532376 -2 Left 922532373 1:226354149-226354171 CCCTGGGCAGAAACATGAGTTCA No data
Right 922532376 1:226354170-226354192 CACAGCAAAAAGACAAGCTAGGG No data
922532367_922532376 23 Left 922532367 1:226354124-226354146 CCCAGTCAAGGAAAGCAGGACCA No data
Right 922532376 1:226354170-226354192 CACAGCAAAAAGACAAGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922532376 Original CRISPR CACAGCAAAAAGACAAGCTA GGG Intergenic
No off target data available for this crispr