ID: 922532378

View in Genome Browser
Species Human (GRCh38)
Location 1:226354186-226354208
Sequence GCTAGGGAGGAAAAGACGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922532372_922532378 15 Left 922532372 1:226354148-226354170 CCCCTGGGCAGAAACATGAGTTC No data
Right 922532378 1:226354186-226354208 GCTAGGGAGGAAAAGACGTTTGG No data
922532374_922532378 13 Left 922532374 1:226354150-226354172 CCTGGGCAGAAACATGAGTTCAC No data
Right 922532378 1:226354186-226354208 GCTAGGGAGGAAAAGACGTTTGG No data
922532371_922532378 19 Left 922532371 1:226354144-226354166 CCATCCCCTGGGCAGAAACATGA No data
Right 922532378 1:226354186-226354208 GCTAGGGAGGAAAAGACGTTTGG No data
922532373_922532378 14 Left 922532373 1:226354149-226354171 CCCTGGGCAGAAACATGAGTTCA No data
Right 922532378 1:226354186-226354208 GCTAGGGAGGAAAAGACGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922532378 Original CRISPR GCTAGGGAGGAAAAGACGTT TGG Intergenic
No off target data available for this crispr