ID: 922533002

View in Genome Browser
Species Human (GRCh38)
Location 1:226358623-226358645
Sequence CCTTCCATGCTGAGGCTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922532995_922533002 27 Left 922532995 1:226358573-226358595 CCATACAAATGGGCATATTTGGC 0: 1
1: 0
2: 2
3: 10
4: 122
Right 922533002 1:226358623-226358645 CCTTCCATGCTGAGGCTGAATGG 0: 1
1: 0
2: 2
3: 18
4: 209
922532998_922533002 -1 Left 922532998 1:226358601-226358623 CCAAAGGGAAGCTGCCATCTAAC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 922533002 1:226358623-226358645 CCTTCCATGCTGAGGCTGAATGG 0: 1
1: 0
2: 2
3: 18
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922533002 Original CRISPR CCTTCCATGCTGAGGCTGAA TGG Intergenic
900882814 1:5394113-5394135 CTTTCCATCCTGCAGCTGAAGGG - Intergenic
901325340 1:8361924-8361946 ATTTCCTTGCTGAGGCTGATGGG - Intronic
903325884 1:22568295-22568317 CCTACCATGTTGAGCCTGCAGGG + Intronic
905223887 1:36467007-36467029 CTGACCATGCTGAGTCTGAACGG - Intronic
905897183 1:41555966-41555988 CCTTCCATGTTAAGGTTGAGTGG + Intronic
906126209 1:43428419-43428441 TCCTCCATGCTGCTGCTGAAGGG - Exonic
910489526 1:87753365-87753387 CATTCCCTTCTGAGGCTAAAAGG + Intergenic
913044847 1:115065146-115065168 CATTGCTTGCTGAAGCTGAAGGG + Intronic
913277262 1:117150949-117150971 CCTTCCTTTTTGAGCCTGAATGG + Intronic
915658054 1:157377774-157377796 CCGTCCAAGCCCAGGCTGAAGGG - Intergenic
917301124 1:173575078-173575100 CCTTCCAGGCTGAGGGGCAATGG - Intronic
922362266 1:224833972-224833994 CCTTCCCTGCTGAGACAGCATGG + Intergenic
922533002 1:226358623-226358645 CCTTCCATGCTGAGGCTGAATGG + Intergenic
922725842 1:227922665-227922687 CCCTCCCTGCTGAGGGTGAGGGG - Intronic
923920549 1:238559699-238559721 CCTTCCCTTCTCAGGCTGTATGG + Intergenic
924824708 1:247527150-247527172 CCTTAAATGCTCAGGCTGATTGG - Intronic
1065622679 10:27599629-27599651 ACTTCCAAACTGTGGCTGAAAGG + Intergenic
1066754814 10:38700571-38700593 CTTTCCAGGCTGAGGTTGCATGG + Intergenic
1068399227 10:56507484-56507506 CCTTCCATGCTGAAAAGGAAGGG + Intergenic
1069842408 10:71348039-71348061 CCTGCCATGCTGAGGCAGCAGGG + Intronic
1069898138 10:71691611-71691633 CCTTCCATGTTGTGGCTCCAAGG + Intronic
1072427194 10:95339444-95339466 CCTTCCCTGCTGAACCTGGAGGG + Intronic
1075094396 10:119461330-119461352 CCTGCCATGCTGTGGCTCAAGGG - Intergenic
1075771820 10:124944907-124944929 CCTCCCATCCTGAGGATGAGGGG + Intronic
1076615366 10:131751153-131751175 CTTTCCATCCTGAGGCTCCAGGG - Intergenic
1076796668 10:132801684-132801706 GCTTCCCTGGGGAGGCTGAAGGG - Intergenic
1084535439 11:69753619-69753641 ACTTCCACGCTGATGCTCAAAGG + Intergenic
1084891342 11:72238551-72238573 CCTTCCGTCCTGAGCCTAAAAGG - Exonic
1084936921 11:72591805-72591827 CCTGCCATGGTGAGGATGGACGG + Intronic
1085283638 11:75346327-75346349 CCTTTCAGGCTCAGGCTGAGGGG - Intronic
1088945928 11:114512534-114512556 CCATCCATCCTCAGGCTTAAAGG + Intergenic
1089213823 11:116823536-116823558 CCTTCCATGCTGAGGTTGGTGGG - Intergenic
1090405798 11:126475270-126475292 CCATGCAGGCTGAGGCTGGAAGG - Intronic
1091037079 11:132244065-132244087 CATTCCAGGCTGGGGCTGACAGG + Intronic
1091104089 11:132902204-132902226 CATTGCAAACTGAGGCTGAATGG + Intronic
1092170483 12:6371036-6371058 ACTTCCTTGCTTAGTCTGAAAGG + Intronic
1092265058 12:6974467-6974489 CCTTCCATACAGAGGCTCAAAGG - Intronic
1092577967 12:9811013-9811035 CCAGCAATGGTGAGGCTGAAGGG + Intergenic
1092847847 12:12600610-12600632 CGTTCCATGCTGAGTGGGAAAGG + Intergenic
1096973530 12:55685378-55685400 CCATCCCTGCTGCGGCAGAAAGG + Intronic
1100618652 12:96250599-96250621 CCTTCACTCCTGAGGCCGAAAGG - Intronic
1101918087 12:108911708-108911730 CCCTCCTTGGTCAGGCTGAATGG - Exonic
1103346427 12:120253771-120253793 CCTTCCATGCTGTGGCAAATGGG - Intronic
1103800019 12:123532217-123532239 CCTCCCATTCTCAGTCTGAAGGG + Intronic
1104277161 12:127340275-127340297 CCTTCCACACTGAGGGTGAGGGG - Intergenic
1104846294 12:131848757-131848779 CCTTCCTGGCTGAGGCTGAGCGG + Intronic
1108130010 13:47288603-47288625 CCCTCAAATCTGAGGCTGAAAGG + Intergenic
1110575610 13:77051874-77051896 GCTGCGATGCTGAGGCTGGACGG - Exonic
1110838095 13:80108213-80108235 CCTTGCATTCTGAGGTGGAATGG + Intergenic
1111484872 13:88883616-88883638 CCTTCCATGTTGATGTTGATGGG + Intergenic
1112041564 13:95552952-95552974 CCCTCCATGCTGGCGCTGGACGG + Exonic
1112431766 13:99356280-99356302 CATTCCATGCAGGGGCTAAAAGG - Intronic
1112558197 13:100488528-100488550 CCTTGGAGGCTGAGGCTGGAGGG + Intronic
1114484500 14:23054887-23054909 CCTTCCCTGCTGCTGCTGAATGG - Intronic
1115890569 14:38023041-38023063 ACTTCCCTGCTGAGGTTAAATGG - Intronic
1117200144 14:53381880-53381902 GGTTCCATGCTGGGCCTGAAGGG + Intergenic
1121404091 14:93708248-93708270 CTCTCCATACTGAGCCTGAATGG - Intergenic
1129834728 15:78694991-78695013 CCTCCTATTCTGAGGCTGCAAGG - Intronic
1129873736 15:78958597-78958619 GCCTCCCTGCTGAGGCTGGAAGG + Intergenic
1130986031 15:88845389-88845411 CCTTCCCTGCTGGGGCAGGAGGG - Intronic
1132112138 15:99109404-99109426 CCTTAGCTGCTGAGGCTGACTGG + Intronic
1132661200 16:1062280-1062302 CCGTCCTTGCTGTGGCTGACGGG + Intergenic
1135263520 16:21001357-21001379 CCTTCTATGTCTAGGCTGAAAGG + Intronic
1136376391 16:29867980-29868002 CCTTGCTGGCTGAGGCTGGAGGG - Intergenic
1136727874 16:32376267-32376289 CTTTCCAGGCTGAGGTTGCATGG - Intergenic
1137589749 16:49686366-49686388 TCTTCCATGCTGGGGCAGGAGGG + Intronic
1138813301 16:60175793-60175815 CCTCCTTTGCTGAGGCTAAAAGG + Intergenic
1138912739 16:61421946-61421968 CCCAGGATGCTGAGGCTGAAGGG + Intergenic
1139476306 16:67204208-67204230 CCCTCCATGCTGGGCCTGCAGGG + Intergenic
1139578204 16:67855797-67855819 TCTTCCATTCTGAGGCTCCATGG + Intronic
1142083924 16:88165948-88165970 CCTTCCCTTTTGAGGCTGAGTGG + Intergenic
1142237244 16:88928059-88928081 CCTTCCCTGCTGGGGTTCAAAGG - Intronic
1202998561 16_KI270728v1_random:141487-141509 CTTTCCAGGCTGAGGTTGCATGG + Intergenic
1203130158 16_KI270728v1_random:1677891-1677913 CTTTCCAGGCTGAGGTTGCATGG + Intergenic
1142870092 17:2814475-2814497 CCTTCCATGCCGATGGGGAAGGG - Intronic
1144029745 17:11308831-11308853 CCTTCCAGTCTGACTCTGAAAGG - Intronic
1147042149 17:37727345-37727367 CCTTCCAGGCTGAAGATAAATGG + Intronic
1148090772 17:45021393-45021415 CCTTCCATGATGAGCCTCCATGG - Intergenic
1148806655 17:50267240-50267262 TCTTCCAGGCTGGGGCTGAAAGG - Intergenic
1149979982 17:61303021-61303043 CCTTCCATGGCCAGTCTGAAAGG - Intronic
1151192617 17:72409423-72409445 CTTTTCTTGCTGAGGCTGCAGGG - Intergenic
1152582161 17:81170928-81170950 TCTTCCAGGCTGAGGCAGCAGGG + Intergenic
1156861364 18:41839997-41840019 TCTTCCCTGCTGAGGCTGTCAGG - Intergenic
1156929074 18:42618939-42618961 CCTTCTATGCTTTTGCTGAATGG + Intergenic
1156996855 18:43479173-43479195 CCTTCCATACTGAGGTTAATAGG + Intergenic
1160284403 18:77527607-77527629 CCTTTCATGCTCAGAGTGAAGGG - Intergenic
1160623050 18:80184226-80184248 CCATCAGTGCCGAGGCTGAAAGG - Intronic
1161601017 19:5182814-5182836 GCTTCCAGGATGAGCCTGAATGG - Intronic
1161708740 19:5835134-5835156 CCTTCAAAGCTGAGGCTCAGTGG - Intronic
1162152864 19:8657923-8657945 ACTTCAAGGCTGAGGCTGAGGGG + Intergenic
1162219319 19:9162695-9162717 CCTTTCTTGATGAGGCTTAAGGG - Exonic
1162528550 19:11222108-11222130 CCCTCGAACCTGAGGCTGAAGGG - Exonic
1163024052 19:14499397-14499419 ACTTGGAGGCTGAGGCTGAAAGG + Intergenic
1163850037 19:19657477-19657499 CCTGCCATGCTCAGGTTGGAGGG - Intronic
1167410655 19:49341858-49341880 CCTTCCCTGGTGAAGCTGACTGG - Intronic
1167770250 19:51510333-51510355 CCTGCCACCTTGAGGCTGAAAGG + Intergenic
1168029010 19:53664966-53664988 CTTCCCATCCTGAGGATGAAAGG - Intergenic
925154070 2:1637026-1637048 CCTTCCACCCTCAGGATGAACGG - Intronic
926888321 2:17617760-17617782 CCTGACAAGCTGAGGATGAACGG - Intronic
927006370 2:18853599-18853621 CCTTCTATCCAGAGGTTGAATGG + Intergenic
931343509 2:61425612-61425634 CCCTCCATGGTGAGGCTGGTGGG - Intronic
932369639 2:71176484-71176506 CCTCCTATTCTGAGGCTGCAAGG - Intergenic
934318101 2:91944806-91944828 CTTTCCAGGCTGAGGTTGCATGG + Intergenic
936630622 2:114199018-114199040 CTTTCCAGGCTGAGGGAGAAAGG - Intergenic
939579868 2:143935749-143935771 CCTTCCAAACTGCGGCTAAAGGG - Intergenic
940899906 2:159117104-159117126 TCCTCTATGCTGAGGGTGAAAGG + Intronic
942427701 2:175877116-175877138 CCTTCCTTCCAGAGGCTGAAAGG - Intergenic
943150899 2:184111330-184111352 TGTTCCATTCTGAGGGTGAAAGG + Intergenic
945172154 2:207008051-207008073 CCTTCCTTTCAGAGGATGAAGGG + Intergenic
945442371 2:209895262-209895284 CCTTGCATACAGAGACTGAATGG - Intronic
947508260 2:230726804-230726826 CCTTCCCTACAGAAGCTGAAAGG + Intronic
1170285798 20:14707034-14707056 CCTTAAATGATCAGGCTGAATGG + Intronic
1170414034 20:16121064-16121086 CTTTCCCTGCTCAGTCTGAATGG + Intergenic
1171077500 20:22143707-22143729 CCTTTCATGATGTGGCTGCATGG + Intergenic
1173244016 20:41321888-41321910 CCTACCATACTGAGGCTATATGG + Intergenic
1174385572 20:50186880-50186902 CCTTCCATGCTGTGGCTCTCCGG - Intergenic
1174485006 20:50855560-50855582 CCTTCCAGTCTGAGGAGGAAGGG - Intronic
1175213354 20:57375593-57375615 CCTTCCATGCTTAGACAGAGGGG - Intronic
1175293539 20:57893997-57894019 CTTTCCATTCTGAGGCTGAAGGG + Intergenic
1175594598 20:60220905-60220927 CCATCCACGCTGAGAGTGAATGG - Intergenic
1175988184 20:62774676-62774698 CCTTCCAGGCAGGGGCTGAGGGG + Intergenic
1178005564 21:28216237-28216259 TCTTTCATGCTGTGTCTGAATGG - Intergenic
1179286734 21:39983914-39983936 CCTCTGAAGCTGAGGCTGAAAGG + Intergenic
1180306273 22:11128490-11128512 CTTTCCAGGCTGAGGTTGCATGG + Intergenic
1180544792 22:16490673-16490695 CTTTCCAGGCTGAGGTTGCATGG + Intergenic
1180844261 22:18972857-18972879 ACTTCCAGGCTGAGGCTGGGCGG + Intergenic
1181036155 22:20170648-20170670 GCTTCTCTGCTGAGGCTGGATGG - Intergenic
1181057210 22:20265854-20265876 ACTTCCAGGCTGAGGCTGGGCGG - Intronic
1181841147 22:25662691-25662713 CCTTCCCTACTGAGGCAGCAAGG - Intronic
1182020973 22:27081174-27081196 CCTTCCAGCCCTAGGCTGAAGGG - Intergenic
1183191779 22:36326252-36326274 CCTCCCCTTCTGAGGCTGGAAGG - Intronic
1183344646 22:37300621-37300643 CCTTCCCAGCTGAGGCAGACTGG + Intronic
1183650772 22:39152290-39152312 CCCTCCACGCTGGGGCTGAAGGG - Intronic
1184404524 22:44292507-44292529 CCTCCCATGGTGAGGATTAATGG + Intronic
1185169747 22:49285892-49285914 CTTTACATCCTGAGGCTGGAAGG + Intergenic
949107420 3:217519-217541 CCTTTCACGCTGAGCCAGAAAGG + Intronic
951907529 3:27720048-27720070 CCTTCCATTCTGAGGCCTAGAGG - Intronic
952822834 3:37499672-37499694 CCCTCAGGGCTGAGGCTGAAGGG - Intronic
956249559 3:67221475-67221497 CCTTCCAGGCTGAGGAGGAGTGG + Intergenic
958885106 3:99717325-99717347 CCTGCCAAGCATAGGCTGAAAGG - Intronic
958908346 3:99966036-99966058 CCTTCCCTGCTGAGGTTAATAGG + Intronic
961459424 3:127040816-127040838 CCTTCCTTTCAAAGGCTGAATGG - Intergenic
962355099 3:134686948-134686970 TCCTCCATGCAGAGTCTGAAGGG + Intronic
964743077 3:159987981-159988003 TCCTTCATGCTGTGGCTGAAGGG + Intergenic
966121607 3:176527933-176527955 CCTGCCCTGCTGAGGCTGTCTGG + Intergenic
966847952 3:184145039-184145061 CCATCCAGGCTGAGACTGAAAGG + Exonic
969210596 4:5684349-5684371 CCTTCCACCCTGAGGCTGCGAGG - Intronic
971346125 4:25813360-25813382 CCTTTCATTTTAAGGCTGAATGG - Intronic
979107437 4:116705674-116705696 CCTTCCTTGCAGAGGCTGCAGGG - Intergenic
980905441 4:138944144-138944166 CCTTCCATGCTCTGGCTACACGG - Intergenic
982059486 4:151590137-151590159 TCTTCCATGCAGAGGCTTAGAGG - Intronic
989201836 5:38771746-38771768 ATTTCCATGCTGGGGCTGAGAGG - Intergenic
990097153 5:52130973-52130995 CCTTCCATGCTCTGTCTGTACGG - Intergenic
990979369 5:61587863-61587885 CCTACCAACCTTAGGCTGAAGGG + Intergenic
994177531 5:96728069-96728091 ACCTCCATGCAGAGGCAGAATGG - Intronic
994815375 5:104580021-104580043 GCTTCCATGCAGAGGTTGAGTGG + Intergenic
997267371 5:132502681-132502703 GCTGCCATGCTGAGGCTGGTGGG + Intergenic
998444974 5:142191611-142191633 ACTTCGATCCTGAGGCTGAGGGG - Intergenic
998504365 5:142660276-142660298 CCTTCCAGTCAGAGGCTGAGTGG - Intronic
999181841 5:149675371-149675393 CCTTCCTTGGAGAGGCTGATAGG - Intergenic
999347790 5:150839789-150839811 CCTGCCTTGCTGTGGCTGAGTGG + Intergenic
999673642 5:153978217-153978239 CCTTCCAAACTCAGGCTGAGTGG - Intergenic
999889076 5:155957250-155957272 CCTTCAGTGCTGAGGCTGCTGGG + Intronic
1001919798 5:175590912-175590934 CCTTTCATGCAGAGGCTGCTAGG - Intergenic
1002209628 5:177589827-177589849 CCATCCTTTCTAAGGCTGAAAGG + Intergenic
1004789792 6:19012099-19012121 CCTTCATTGCAAAGGCTGAAGGG + Intergenic
1004825099 6:19411415-19411437 CCTGCCATGCTGGGGTTGAAGGG + Intergenic
1005065585 6:21814584-21814606 CCTGGCTTCCTGAGGCTGAAGGG + Intergenic
1008233859 6:49019379-49019401 CCTTCCAAGATGACTCTGAAGGG + Intergenic
1009035280 6:58110338-58110360 ACTTCCAAAATGAGGCTGAAGGG - Intergenic
1010922068 6:81694265-81694287 CCTTCCTTTCTAGGGCTGAATGG + Intronic
1016378062 6:143444300-143444322 CCTGCCATGCTGAGGATGAGTGG + Intronic
1016582517 6:145645545-145645567 CCTTCGAGGCTGAAGCAGAAGGG - Intronic
1018031395 6:159844710-159844732 CCTTCCATCCCCAGGCTGAGAGG + Intergenic
1018696728 6:166396682-166396704 CCTTCCTTGCTGAGGCCACAGGG - Intergenic
1018874745 6:167811913-167811935 CCTCCCATGAGGGGGCTGAAGGG + Intergenic
1019012830 6:168856038-168856060 CATTCCATGCTGAGGTGCAAAGG + Intergenic
1022037249 7:26546130-26546152 CCTTCCATCTTCTGGCTGAAAGG + Intergenic
1022413016 7:30154024-30154046 CCTTCCCTACTGAGGTTAAAGGG - Intronic
1023650546 7:42364514-42364536 CCCTGCATGCTGTGGCTTAAAGG - Intergenic
1026138385 7:67683458-67683480 CCAACCCTGCTGATGCTGAATGG + Intergenic
1026600260 7:71771758-71771780 AATTCCATTCTGAGTCTGAAGGG - Intergenic
1029054140 7:97722548-97722570 CCTTCCTTTTTAAGGCTGAATGG - Intergenic
1030805485 7:113912859-113912881 TCTCTCATGCTGTGGCTGAAAGG - Intronic
1031734870 7:125346125-125346147 TCTGCCATGCCAAGGCTGAATGG + Intergenic
1034324395 7:150217414-150217436 TCTTCAAACCTGAGGCTGAAAGG + Intergenic
1034499091 7:151438722-151438744 CCTTCACTGGAGAGGCTGAATGG + Intronic
1034768799 7:153751817-153751839 TCTTCAAACCTGAGGCTGAAAGG - Intergenic
1035542542 8:453094-453116 CCTTCTGTGCTGAGGCAGAGAGG - Intronic
1035707149 8:1685120-1685142 TCTTCCATGCTGAGACAAAATGG + Intronic
1036162519 8:6402881-6402903 CCTTGCAAGCTGAAGCTGGATGG + Intergenic
1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG + Intronic
1037419434 8:18686759-18686781 CCTTCCATGCATGGGCTGAGTGG - Intronic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1038455989 8:27672265-27672287 CCTTCCAGGCTGCTCCTGAAGGG - Exonic
1039339047 8:36626794-36626816 CCCTCCATGGTGAGGCTGAGTGG + Intergenic
1039659142 8:39444572-39444594 CCTTCCTTGCTGAGCATGGAAGG - Intergenic
1042325979 8:67528328-67528350 GCTTCCATGCAGAGGCTGGTTGG + Intronic
1044370447 8:91403970-91403992 CCTTCCAGCCTGAGGCTATATGG + Intergenic
1046406018 8:113773690-113773712 CATTACTTGCTGAAGCTGAAGGG - Intergenic
1048404316 8:134104456-134104478 CACTCCCTGCTGATGCTGAATGG + Intergenic
1049132964 8:140865490-140865512 TCTTCCATTCTGTGGCTTAATGG + Intronic
1049352052 8:142169783-142169805 CCCTCCATGCTGAGGGTGTCAGG - Intergenic
1049352069 8:142169833-142169855 CCCTCCATGCTGAGGGTGTCAGG - Intergenic
1049352086 8:142169883-142169905 CCCTCCATGCTGAGGGTGTCAGG - Intergenic
1049591951 8:143466691-143466713 GGCTCCATGCTGAGGCTGGACGG - Intronic
1050150749 9:2617242-2617264 CTTTCTATGCTGAGGCTGTGGGG + Intergenic
1051214813 9:14785595-14785617 CCTTCCCTTTTAAGGCTGAATGG - Intronic
1055319795 9:75071982-75072004 CCTGCCTTGCTAATGCTGAATGG + Intronic
1056998340 9:91484584-91484606 CCCACCATGCTGAGGGTGTATGG + Intergenic
1058800503 9:108540648-108540670 CCTTCCCTCCTGAGGAAGAAGGG - Intergenic
1059432459 9:114258388-114258410 CCTTCCATGTGGAGGCTGCTGGG + Intronic
1060202730 9:121661135-121661157 CCTTGGATGCTGATGCTGCAGGG + Intronic
1060716055 9:125930107-125930129 CTTTCCATTCTGATGCTAAAAGG + Intronic
1062678075 9:137760030-137760052 CCTGCCTTATTGAGGCTGAATGG + Intronic
1186723951 X:12336735-12336757 AATCCCATGCTGAGCCTGAAAGG + Intronic
1186830706 X:13387316-13387338 TCTTCCCTGCTGAGTCTGAAGGG - Intergenic
1192212600 X:69137283-69137305 CCTTTCATGCGGGGGCTGAATGG - Intergenic
1192451892 X:71249949-71249971 CCTCCCATCCTGGGGCTGCAGGG - Intronic
1193499113 X:82251438-82251460 CCTTTCCTGATGAGGCTCAAAGG + Intergenic
1194358779 X:92920612-92920634 CATACCATGCTGAAGCTGCAGGG + Intergenic
1195656662 X:107337779-107337801 CATTCCATGATGAGGCTGATTGG + Intergenic
1196153782 X:112405079-112405101 CTTTCCATGCTGAGGCAGCATGG - Intergenic
1198973806 X:142312153-142312175 GCTTCCATGCTGGAGCAGAATGG - Intergenic
1200666945 Y:6036306-6036328 CATACCATGCTGAAGCTGCAGGG + Intergenic
1201038075 Y:9803029-9803051 CCTTCCAGGCCTAGGATGAAGGG + Intergenic
1201185656 Y:11399888-11399910 CTTTCCAGGCTGAGGTTGCATGG + Intergenic
1202231445 Y:22663259-22663281 GCTTCCATGGAGAAGCTGAAAGG - Intergenic
1202311713 Y:23532906-23532928 GCTTCCATGGAGAAGCTGAAAGG + Intergenic
1202559089 Y:26137688-26137710 GCTTCCATGGAGAAGCTGAAAGG - Intergenic