ID: 922533836

View in Genome Browser
Species Human (GRCh38)
Location 1:226365072-226365094
Sequence AACCGAAGATTGCTGTGGCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 69}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922533836_922533839 -5 Left 922533836 1:226365072-226365094 CCGTGCCACAGCAATCTTCGGTT 0: 1
1: 0
2: 1
3: 2
4: 69
Right 922533839 1:226365090-226365112 CGGTTATGAAGCTGCTTAAAGGG 0: 1
1: 1
2: 0
3: 7
4: 69
922533836_922533838 -6 Left 922533836 1:226365072-226365094 CCGTGCCACAGCAATCTTCGGTT 0: 1
1: 0
2: 1
3: 2
4: 69
Right 922533838 1:226365089-226365111 TCGGTTATGAAGCTGCTTAAAGG 0: 1
1: 1
2: 0
3: 3
4: 60
922533836_922533840 8 Left 922533836 1:226365072-226365094 CCGTGCCACAGCAATCTTCGGTT 0: 1
1: 0
2: 1
3: 2
4: 69
Right 922533840 1:226365103-226365125 GCTTAAAGGGCTTGTAACGCTGG 0: 1
1: 0
2: 1
3: 1
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922533836 Original CRISPR AACCGAAGATTGCTGTGGCA CGG (reversed) Exonic
904417108 1:30369882-30369904 AACCAAAGATTTCTGTGCCTTGG - Intergenic
907306557 1:53516378-53516400 AACCGAGCAGGGCTGTGGCAGGG + Intronic
908513640 1:64870572-64870594 AACCGAATGTGGCTGTAGCACGG - Intronic
911580955 1:99632725-99632747 AAGCCATGATTGTTGTGGCATGG - Intergenic
913219658 1:116649201-116649223 AGCCCAAGGCTGCTGTGGCATGG + Intronic
917633509 1:176913618-176913640 AAGCGATTATTGCTGGGGCAGGG + Intronic
918391185 1:184064429-184064451 AGCCCTAGATTGGTGTGGCATGG + Intronic
922533836 1:226365072-226365094 AACCGAAGATTGCTGTGGCACGG - Exonic
922611798 1:226935895-226935917 AACCAAAGATTCCTGTGCCTGGG - Intronic
1075216157 10:120537945-120537967 AACAGAAGGTTTCTGTGGCAGGG - Intronic
1076380372 10:130021157-130021179 AACCGAAGATCACTGTGTGATGG + Intergenic
1085877002 11:80420271-80420293 AACCGGAAATTGCTCTGGGAGGG - Intergenic
1087869906 11:103279988-103280010 AACTGAAGATTGCTAATGCATGG + Intronic
1090183582 11:124721477-124721499 AAAAGAACATTGCTGTGTCAAGG - Intergenic
1092578638 12:9816110-9816132 AGAAGAAGATTGCTGTGGCCAGG - Intergenic
1107702805 13:43065015-43065037 AACAAAAGATTTATGTGGCAAGG - Intronic
1108761384 13:53570036-53570058 AACCTAAGATTGCTGTACCAGGG - Intergenic
1113520807 13:110939312-110939334 AACTGAAGGTTGCTGTGGCATGG + Intergenic
1114140229 14:19901348-19901370 CACAGAAGAATACTGTGGCAAGG + Intergenic
1121579875 14:95021636-95021658 AACCCAAGATTGCTGCCTCACGG + Intergenic
1125523857 15:40363549-40363571 AACTGAATAATGCTGGGGCATGG + Intronic
1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG + Intronic
1133632146 16:7631366-7631388 AACCGAAGATTTCTCTGCCTCGG + Intronic
1134457931 16:14408133-14408155 AACTGAGGTTTGCTGTGGCTGGG + Intergenic
1137805039 16:51296993-51297015 ACCCAAAGATTGCTGAGGTAAGG - Intergenic
1140878846 16:79179034-79179056 CACAGAATATTGCTGAGGCAGGG - Intronic
1146715953 17:35087676-35087698 AATTGCAGATTGATGTGGCAGGG - Intronic
1147149680 17:38507391-38507413 ATCATAAGATTGCTGTGACAGGG + Intronic
1156996314 18:43471984-43472006 AATCAGAGCTTGCTGTGGCAAGG + Intergenic
1167499810 19:49839162-49839184 GACCGAAGAAGTCTGTGGCATGG + Intergenic
927429847 2:23018330-23018352 CCCCGAAGATTCCTGTGACAGGG + Intergenic
930432236 2:51293487-51293509 AAGTGAAGATTTCTGTGGCTTGG - Intergenic
933611727 2:84443705-84443727 AAGCCAAGATTGTTGTGGGAGGG - Intronic
1175797341 20:61780148-61780170 AACTGGAGCTTGCTGTGCCAAGG - Intronic
1176362175 21:6006744-6006766 ATCAGAAGACTGCTGTGGCCAGG - Intergenic
1179534418 21:42042114-42042136 AACCGAAGTTCCCTCTGGCAGGG + Intergenic
1179761343 21:43531801-43531823 ATCAGAAGACTGCTGTGGCCAGG + Intronic
1180820950 22:18827259-18827281 AGCCCAAGGCTGCTGTGGCATGG + Intergenic
1180886655 22:19249881-19249903 AAGGGAAGATTGCTTTTGCATGG - Intronic
1181192027 22:21148786-21148808 AGCCCAAGGCTGCTGTGGCATGG - Intergenic
1181207170 22:21261724-21261746 AGCCCAAGGCTGCTGTGGCATGG + Intergenic
1184406933 22:44305674-44305696 AACCACAGCGTGCTGTGGCAGGG - Intronic
1203219750 22_KI270731v1_random:33692-33714 AGCCCAAGGCTGCTGTGGCATGG - Intergenic
1203271077 22_KI270734v1_random:53135-53157 AGCCCAAGGCTGCTGTGGCATGG + Intergenic
952150104 3:30580018-30580040 AACCCAGGATCTCTGTGGCAGGG + Intergenic
957845412 3:85727526-85727548 GACAGAAAATTACTGTGGCAAGG - Intronic
960255924 3:115511724-115511746 AACCAAAGTTTTATGTGGCATGG + Intergenic
969380213 4:6790805-6790827 AACCAAAGAAAGCAGTGGCAAGG - Intronic
970614767 4:17758770-17758792 AACTGCAGAGTGCTGTGGGAAGG - Intronic
971409339 4:26353905-26353927 AACAAAAGAATACTGTGGCAGGG - Intronic
974610371 4:64208638-64208660 AACAGAAGATTGAGGTGGTATGG - Intergenic
981633172 4:146845112-146845134 TTGTGAAGATTGCTGTGGCAAGG - Intronic
982253504 4:153431051-153431073 AACTGAGGATTGGAGTGGCATGG + Intergenic
985031541 4:185795378-185795400 GATCAAAGATTGCTGAGGCAGGG - Intronic
985897425 5:2757042-2757064 AACAGAAGATTGCAGAGCCACGG - Intergenic
986867884 5:12011151-12011173 AACTGAAGATATCTGTGGGATGG - Intergenic
992968026 5:82023062-82023084 AACTAAAGTTTGCTGGGGCAGGG - Intronic
993845817 5:92942048-92942070 ATCCAAAGATGCCTGTGGCATGG + Intergenic
1004799816 6:19134195-19134217 TACTGGAGAGTGCTGTGGCAGGG + Intergenic
1007192025 6:40027593-40027615 AACCCACGAAAGCTGTGGCATGG + Intergenic
1007511510 6:42377847-42377869 AACCTAAGATGGAAGTGGCAAGG + Intronic
1010792389 6:80079614-80079636 AACAGAAGATTGTTGTTGTAAGG - Intergenic
1021558866 7:21948738-21948760 AATCGAAGTTTTATGTGGCATGG - Intergenic
1023630194 7:42156016-42156038 CAGCGAAGATTGCTGTGACCTGG + Intronic
1037064673 8:14563066-14563088 AACTGAAGATAGCTGTGCTATGG + Intronic
1037860117 8:22399047-22399069 AAACGAAGTGTGCTGTGGCTTGG - Intronic
1039272584 8:35899158-35899180 AACCGAACATTGCTAGGGCTGGG - Intergenic
1049822972 8:144647346-144647368 ACCCGCAGACTGCTGTGTCAAGG + Intergenic
1050101822 9:2127741-2127763 AACCTAAGTGTGCTGAGGCAGGG - Intronic
1187269206 X:17764814-17764836 AACAGGAGATGGCTGTGGCTTGG - Intergenic
1190913650 X:54794124-54794146 AACAGAGTATTGCTGTGGCTGGG + Intronic
1194142292 X:90221228-90221250 AACTGAAGAATGCTGGGGCCCGG - Intergenic
1200488045 Y:3790329-3790351 AACTGAAGAATGCTGGGGCCCGG - Intergenic