ID: 922536761

View in Genome Browser
Species Human (GRCh38)
Location 1:226386669-226386691
Sequence AGGAAGCCCTAAGGGTGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 212}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922536751_922536761 28 Left 922536751 1:226386618-226386640 CCAAATTAAACCTGCTGTGTGGT 0: 1
1: 0
2: 0
3: 13
4: 130
Right 922536761 1:226386669-226386691 AGGAAGCCCTAAGGGTGTGGGGG 0: 1
1: 0
2: 1
3: 20
4: 212
922536752_922536761 18 Left 922536752 1:226386628-226386650 CCTGCTGTGTGGTCTCTCAGAGA 0: 1
1: 0
2: 4
3: 15
4: 198
Right 922536761 1:226386669-226386691 AGGAAGCCCTAAGGGTGTGGGGG 0: 1
1: 0
2: 1
3: 20
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922536761 Original CRISPR AGGAAGCCCTAAGGGTGTGG GGG Intronic