ID: 922536847

View in Genome Browser
Species Human (GRCh38)
Location 1:226387334-226387356
Sequence CCTCTCCATTTTAAAGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 266}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922536843_922536847 28 Left 922536843 1:226387283-226387305 CCTCATCTCATTTATTCTCATAA 0: 1
1: 1
2: 1
3: 49
4: 575
Right 922536847 1:226387334-226387356 CCTCTCCATTTTAAAGGCTGAGG 0: 1
1: 0
2: 2
3: 30
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922536847 Original CRISPR CCTCTCCATTTTAAAGGCTG AGG Intronic
902871782 1:19317940-19317962 CCTCTCCAGACTAGAGGCTGGGG + Intronic
903726118 1:25446585-25446607 CATCTGCATTTTAAATGCTCTGG - Intronic
904138812 1:28335470-28335492 CCTTTCTATATTAAAGGCTCAGG + Exonic
904491709 1:30864564-30864586 CCTGCCCATTTTCAAGGCTCTGG - Intergenic
904854628 1:33488630-33488652 CCACTCTCTTTCAAAGGCTGTGG - Exonic
906811721 1:48833921-48833943 CTTTTCCATTTCAAAGGGTGGGG + Intronic
907428377 1:54395801-54395823 CCTCTGGATTTTAAAGGATTTGG - Intronic
908860317 1:68478819-68478841 CGTCTCCAATTTAAAAGCTCTGG - Intronic
909103879 1:71384504-71384526 CCTTTCCTTTTTACAGGCAGAGG - Intergenic
911767462 1:101695068-101695090 ACTCTCCAATTAAAAGGCAGAGG - Intergenic
911853063 1:102842718-102842740 CCTCCCCTTTTGAAAGGCAGAGG - Intergenic
912641140 1:111346896-111346918 CCTCTTTATTTTAGACGCTGCGG + Exonic
913414001 1:118584590-118584612 CCTCTACCTTTTAAAGTATGGGG + Intergenic
913440468 1:118891583-118891605 CATCTCCATTTTAATTACTGTGG - Intronic
915501328 1:156320291-156320313 CCCAACTATTTTAAAGGCTGAGG + Intronic
915558343 1:156672747-156672769 CCACTCCAGTTTAGAGGCTAAGG - Exonic
918207117 1:182319347-182319369 CCTCAGCATTTTCGAGGCTGAGG - Intergenic
921999173 1:221457098-221457120 CCTTTCCATTGTAAAGGCCATGG + Intergenic
922316219 1:224444758-224444780 CCCATCCATTCAAAAGGCTGAGG - Intronic
922536847 1:226387334-226387356 CCTCTCCATTTTAAAGGCTGAGG + Intronic
922694795 1:227724455-227724477 CCTTTTCATTTTAAATGTTGAGG + Intergenic
922842883 1:228658540-228658562 TCTCTCAGTTCTAAAGGCTGGGG - Intergenic
923169488 1:231400747-231400769 CCTCTCAATTTTAAAAGGTTAGG - Intronic
924417673 1:243875012-243875034 ACTCTCCAATTAAAAGGCAGAGG - Intergenic
1063098127 10:2926210-2926232 CCTGTTCATTTTACAGCCTGTGG + Intergenic
1063263822 10:4422907-4422929 CCTCTCCATCAAAAAGCCTGAGG - Intergenic
1063488119 10:6438846-6438868 CCTCGCCCTTTGAAAGGCTAAGG - Intronic
1064694886 10:17955182-17955204 GTTCTCCATTTTCAGGGCTGGGG + Intronic
1067179512 10:43974138-43974160 CCTGGCTATTTTAAAGGCTCAGG - Intergenic
1067364442 10:45612181-45612203 CTCCTCCATTTCAAAGGGTGGGG + Intergenic
1068671332 10:59726650-59726672 CCTGTCCCTTTCAAGGGCTGGGG + Intronic
1069128764 10:64672294-64672316 CCTCTCACTTTGAGAGGCTGAGG - Intergenic
1069933518 10:71899806-71899828 CCTCCCCTTTCTAAAGGCAGAGG + Intergenic
1070606182 10:77899996-77900018 TCTCTTCCTTTTAAAGTCTGGGG - Intronic
1071238594 10:83678580-83678602 TCTCTCTATTTTAGAGTCTGTGG - Intergenic
1071384196 10:85103193-85103215 GGTTTCCATTTTAAAGTCTGGGG + Intergenic
1072640961 10:97211059-97211081 CCCATCCATTTTTAAGGATGAGG - Intronic
1073230673 10:101966893-101966915 CCTCTCCTTTTTTGAGGCAGAGG - Intronic
1075316305 10:121456385-121456407 ACTCTCCTATTTAAAGGCTGTGG - Intergenic
1078265631 11:9754451-9754473 CCTCTGCACTGTAAAAGCTGAGG - Intergenic
1078267607 11:9766608-9766630 CCTCCCCATTTTAACAGCCGAGG - Intergenic
1078897901 11:15614282-15614304 CCTCTCCTTTATAGAGGCTAAGG + Intergenic
1079554865 11:21746798-21746820 CCTCACTAATTTAAAGCCTGAGG - Intergenic
1079787905 11:24698803-24698825 CCTCTCACTTTGGAAGGCTGAGG + Intronic
1082262780 11:50090099-50090121 CCTCTCCATTTTACCTGCTGTGG + Intergenic
1087598338 11:100282822-100282844 CCTCTCCTTTCCAAAGGCAGAGG + Intronic
1088544922 11:110949754-110949776 CCTCTCCATTATCCAGGCTCTGG - Intergenic
1089824650 11:121264424-121264446 CCTCTCCTTTCCAAAGGCAGAGG + Intergenic
1090200302 11:124849475-124849497 CCTAGCCATTTGAGAGGCTGAGG + Intergenic
1090970128 11:131634560-131634582 CCTCTCCAGCATAAAGGCTTGGG - Intronic
1091390205 12:121608-121630 CCTGTCCATTTGGAAGGCTGGGG + Intronic
1095639833 12:44475350-44475372 CCTCCCCTTTCCAAAGGCTGAGG + Intergenic
1095795467 12:46214625-46214647 ATTCTCCAATTTAAAGGGTGAGG - Intronic
1097458654 12:59832987-59833009 CCTCTCCAGTGGAAAGGCTAGGG - Intergenic
1097971030 12:65633452-65633474 CATTTCCAGTGTAAAGGCTGGGG + Intergenic
1097974263 12:65667649-65667671 CCTGCCCTTTTTAAAGCCTGGGG - Intergenic
1100072749 12:90741176-90741198 CATCTTCATATTACAGGCTGAGG - Intergenic
1100419271 12:94415587-94415609 TCTCTCCATTTTAAATAGTGGGG - Intronic
1100879544 12:99000929-99000951 TTTCTTCTTTTTAAAGGCTGAGG + Intronic
1101899119 12:108778032-108778054 CCTCTCACTTTGAGAGGCTGAGG - Intergenic
1104192064 12:126491414-126491436 CCCATCAATTTTAGAGGCTGAGG - Intergenic
1104576330 12:129969602-129969624 CCTTTTTATTTTAAAGTCTGAGG - Intergenic
1105966377 13:25388443-25388465 CCTGTCCCTTTTAAGGGCTCAGG + Intronic
1107056023 13:36104362-36104384 CCTTTCGATTTTATAGGATGAGG - Intronic
1110448727 13:75617635-75617657 CCTCCCCTTTTTATAGGCAGGGG + Intergenic
1112475288 13:99726502-99726524 TCTCTCCAGTTTTAAGTCTGGGG - Intronic
1115522911 14:34251212-34251234 CCTGGACATTATAAAGGCTGAGG - Intronic
1115975738 14:38994980-38995002 CCTTTCCATTTTAAAGGAAATGG - Intergenic
1116216664 14:42025375-42025397 CATCTCCATTTCAAAGGATAGGG - Intergenic
1116407115 14:44579608-44579630 CCTCTCCTTTCCAAAGGCAGAGG - Intergenic
1117264869 14:54076539-54076561 CCTCCCCTTTTCAAAGGCAGAGG + Intergenic
1118122768 14:62864461-62864483 ACTATCCATTTTAAAGCCTCAGG - Intronic
1120804046 14:88726190-88726212 CCTCTCCGTTTAACAAGCTGAGG - Intronic
1122538144 14:102480633-102480655 CCTAGCCATTTTGGAGGCTGAGG - Intronic
1123404654 15:20012551-20012573 CCCCTCCCTTTTCAAGGCTGTGG - Intergenic
1123513987 15:21019198-21019220 CCCCTCCCTTTTCAAGGCTGTGG - Intergenic
1124150205 15:27170824-27170846 CCTTTCCATTTTAAACACTCAGG - Intronic
1126775311 15:52095122-52095144 CCTCTCTATTTTAAAGGCACAGG + Intergenic
1126793574 15:52242326-52242348 CCTCTCCACATTAAACTCTGTGG + Intronic
1129501118 15:76038520-76038542 CCTCTCCTTTTCACAGGCAGAGG - Intronic
1130810615 15:87374271-87374293 CCTCTCCTTTTTGAGGGGTGGGG - Intergenic
1131676076 15:94672062-94672084 CCTCTCCACTGTAAAGGGTTTGG - Intergenic
1132487639 16:203590-203612 CCTAGCTATTTGAAAGGCTGAGG + Intronic
1132767608 16:1542329-1542351 CTTTTCCACTTTAAAGGCTGAGG + Intronic
1134046825 16:11107258-11107280 CCTCTTCATGTTAGAGGGTGCGG + Intronic
1135516896 16:23143631-23143653 GGTAACCATTTTAAAGGCTGGGG + Intronic
1135644118 16:24146433-24146455 CATCTCCATTTTATAAGATGAGG + Intronic
1136171464 16:28492202-28492224 CCGCTCCAGTTTAAAACCTGCGG - Exonic
1138718733 16:59053772-59053794 CCTCTCCAGTATAAAGGCTGTGG + Intergenic
1141573600 16:84950053-84950075 CCTTTCCATTTTAATGTCTCTGG - Intergenic
1143302263 17:5919292-5919314 GCTCTGCATTATAAAAGCTGAGG - Intronic
1143712105 17:8742269-8742291 CCTCTCCCTTTCAGAAGCTGGGG + Intronic
1144039503 17:11396931-11396953 CCCCTCCATTTTCAATGCTCTGG + Intronic
1144930704 17:18856801-18856823 CCTCTCCATTTTAATAGTTGTGG - Intronic
1148530820 17:48389545-48389567 CATTTCCATTTTAAATGCTTGGG + Intronic
1148580613 17:48740879-48740901 ACCCTCAATTTTAAAGGGTGAGG - Intergenic
1149634749 17:58157498-58157520 CCTCTCCATTGCAGAGGGTGCGG + Intergenic
1150473131 17:65454290-65454312 TCTCTCAGTTTTAGAGGCTGGGG - Intergenic
1150505592 17:65695202-65695224 GCTCTCCCTTTTAAAGAGTGCGG - Intronic
1152646854 17:81473184-81473206 CGTCTCCATGTTCAAGGCCGAGG + Intergenic
1155597344 18:27502899-27502921 CCTCTCCTTTCCAAAGGCAGAGG - Intergenic
1157485142 18:48081391-48081413 CCTGGCTGTTTTAAAGGCTGTGG + Intronic
1158359968 18:56660954-56660976 CATTTCCATTTTAAACTCTGAGG - Intronic
1158914483 18:62108481-62108503 CCTCTCCATTTGAAAGGAATAGG - Intronic
1159137643 18:64355618-64355640 TTTCTCAATTCTAAAGGCTGAGG + Intergenic
1159908258 18:74118247-74118269 CCTAGCAATTTGAAAGGCTGAGG - Intronic
1161357929 19:3829626-3829648 CCTGGCCACTTTGAAGGCTGAGG - Intronic
1162444464 19:10713605-10713627 CCTCTCCTTTTTTACAGCTGAGG + Intergenic
1163240181 19:16057778-16057800 GCTTTTCATTTGAAAGGCTGAGG + Intergenic
1164365969 19:27581979-27582001 CATCTCCATATTAAAAGGTGGGG + Intergenic
1164371768 19:27649748-27649770 TCTCTCCATTATAAAGACTGTGG + Intergenic
1164395825 19:27862084-27862106 CCTTTCCATTATAATGCCTGAGG - Intergenic
1165890468 19:39109167-39109189 CCTCTCCATTTTATAGGTGAGGG + Intronic
1166206178 19:41270898-41270920 CCTCCCCATTTTATAGATTGAGG + Intronic
1166666140 19:44681581-44681603 CCTCCCCATTATAAAGGTAGTGG - Intronic
925146500 2:1586453-1586475 CCTCTTCATCTGAAGGGCTGGGG - Intergenic
926595110 2:14781784-14781806 CATCTGCATCTTAAAGGATGGGG - Intergenic
927571664 2:24165716-24165738 ACTTTCCATTTTAAATGTTGGGG - Intronic
928862416 2:35874868-35874890 CCTCCCCTTTCCAAAGGCTGAGG + Intergenic
931899501 2:66771942-66771964 CCTAAAAATTTTAAAGGCTGTGG - Intergenic
931926001 2:67073366-67073388 GCTCTCCATTTTAAGCCCTGAGG + Intergenic
933907170 2:86906317-86906339 CCCCTCCCTTTGGAAGGCTGAGG + Intergenic
933908416 2:86915979-86916001 CCCCTCCCTTTGGAAGGCTGAGG + Intronic
934024307 2:87987401-87987423 CCCCTCCCTTTGGAAGGCTGAGG - Intergenic
934541480 2:95178865-95178887 CCTCACCATTGTAATGGCTACGG - Intronic
934547539 2:95230834-95230856 CATTTCCATTTTAAAGTGTGGGG + Intronic
935835222 2:107043904-107043926 CCTCTCCCTTTCAAAGTCTCTGG - Intergenic
935861532 2:107336437-107336459 CATCTCCATTTTACATGCCGTGG + Intergenic
935997745 2:108792721-108792743 CCCCTCCTTTTTTAAAGCTGGGG + Intronic
936364947 2:111845096-111845118 CCCCTCCCTTTGGAAGGCTGAGG - Intronic
936536286 2:113313962-113313984 CCTCTCCTTCTTCCAGGCTGAGG - Intergenic
937643438 2:124238986-124239008 TCCCTCCATTTTAAAAGCTTTGG + Intronic
939097618 2:137852556-137852578 CCTGACCATTTTAAGGCCTGAGG + Intergenic
939608175 2:144277795-144277817 CCTTTCCTTTTTGAAAGCTGTGG + Intronic
946113163 2:217437840-217437862 CTCCTCCATTTAAAGGGCTGGGG + Intronic
947312293 2:228817916-228817938 CCTCTCCTTTCTAAAGGCAGAGG + Intergenic
1170192841 20:13660830-13660852 CCTCACCCTTTGGAAGGCTGAGG + Intergenic
1170481249 20:16767274-16767296 TCTCTCCATATTGCAGGCTGTGG - Intronic
1171388425 20:24785950-24785972 CCTTCTCATTTTAAAGGCAGAGG + Intergenic
1174539278 20:51276245-51276267 CCTCTCCACCTTTTAGGCTGAGG - Intergenic
1174831802 20:53820345-53820367 CCTCTCCTTTCCAAAGGCAGAGG + Intergenic
1177256826 21:18674399-18674421 ACTTTCCATTTTAATGGCTCTGG - Intergenic
1179035241 21:37753801-37753823 CCTCCCGATTTTCAAGGCAGGGG + Intronic
1183821587 22:40350582-40350604 CCTTAGCATTTTAATGGCTGAGG + Intronic
1184981347 22:48097777-48097799 CCTGTCAATTTTAAAGGGTGAGG - Intergenic
950362207 3:12457545-12457567 CCTAGCTATTTGAAAGGCTGAGG + Intergenic
950713471 3:14830727-14830749 CATCCCCATTTGAAAAGCTGGGG - Intronic
951379792 3:21969123-21969145 CCTCCCCATTTTACAAGCAGAGG - Intronic
952338157 3:32422592-32422614 CCTTTCCTTTTTAAAAGCTAGGG + Intronic
956701027 3:71958525-71958547 CCTCACCAATTTATAGGCTGTGG + Intergenic
957677989 3:83394563-83394585 CCTCTGCTTTGTCAAGGCTGTGG + Intergenic
958669081 3:97180128-97180150 CCTCCCCTTTTCAAAGGCAGAGG + Intronic
958765271 3:98360422-98360444 TCTCCCCTTTTTAAAGGCAGAGG + Intergenic
958876739 3:99625110-99625132 CCTCCCCTTTCTAAAGGCAGAGG - Intergenic
960792151 3:121444747-121444769 CCTCTACATAATAAAAGCTGTGG - Intronic
961790038 3:129369033-129369055 CCTATCTATTTTGGAGGCTGAGG + Intergenic
962599956 3:136984230-136984252 CATCCACATTTTAAAGTCTGAGG - Intronic
963116173 3:141731052-141731074 CCTCGCTATTTGAGAGGCTGAGG + Intergenic
965171192 3:165266166-165266188 CCTGTCACTTTGAAAGGCTGAGG - Intergenic
966239627 3:177742124-177742146 CCTCTACATACAAAAGGCTGAGG - Intergenic
966839410 3:184076612-184076634 CCACTCCCTTTGAGAGGCTGTGG - Intergenic
967427230 3:189340941-189340963 CCCCTTCATTTTAAAGGATTAGG - Intergenic
967581186 3:191156704-191156726 TCTCTCCATTTGAAAGAATGAGG - Intergenic
971701656 4:29984855-29984877 CCTCCCCTTTTTAAAGGCAGAGG - Intergenic
972139438 4:35938489-35938511 CCTCTACATTTTAAAGGGTGAGG + Intergenic
973598674 4:52519279-52519301 CCATTCCATTTTAAATGCTCTGG + Intergenic
974593208 4:63983072-63983094 TCTCCCCTTTCTAAAGGCTGAGG + Intergenic
974634527 4:64543208-64543230 TCTCTCCAGTTTAAGGGATGAGG + Intergenic
974780196 4:66544122-66544144 CCTCCCCTTTTCAAAGGCAGAGG - Intergenic
974941616 4:68476245-68476267 CCTCTCTCTTTTGCAGGCTGCGG + Exonic
975237431 4:72015716-72015738 CCTTTCTACTTTAAAGGATGAGG - Intergenic
975503956 4:75117654-75117676 CCTCCCCTTTTCAAAGGCAGAGG - Intergenic
976946427 4:90774913-90774935 GCTGTCCATTTTTAAGGCTGAGG - Intronic
978008603 4:103651327-103651349 CGTCTTCATTTCAAAGGCAGAGG + Intronic
978550692 4:109922738-109922760 CCTATCAATTTCAAAAGCTGAGG - Intronic
979100204 4:116603544-116603566 CCTCTCCTTTCCAAAGGCAGAGG + Intergenic
979708168 4:123746273-123746295 TCTCTTGATTTTAAAGGATGAGG + Intergenic
984751542 4:183281371-183281393 CCTCCCCTTTTTAAAGGATTGGG - Intronic
985086213 4:186315595-186315617 CCTCTCCAATTTTAAGGCGGTGG - Intergenic
985685765 5:1280750-1280772 CCTCTCCATCTGAAGGGATGTGG - Intronic
986433055 5:7700759-7700781 TCTCTCCATTTCATTGGCTGAGG - Intronic
986693278 5:10331372-10331394 CCTCACCATCTCCAAGGCTGCGG + Intergenic
988811986 5:34794645-34794667 TTCCTCCATTGTAAAGGCTGGGG - Intronic
989000224 5:36752126-36752148 CCCCCCTCTTTTAAAGGCTGAGG - Intergenic
989494400 5:42094779-42094801 CCTATCTATTTTAAATGCAGAGG + Intergenic
989602439 5:43212447-43212469 CCTGAGCATTTTAAAGACTGTGG - Intronic
992124986 5:73630723-73630745 CCTTTCCATTTTACTGGATGAGG - Intronic
994925805 5:106115482-106115504 GCTTCCCATTTGAAAGGCTGAGG - Intergenic
995379015 5:111512059-111512081 CCTCTCCCATTTAACAGCTGAGG + Intronic
996068097 5:119102563-119102585 CCTCTCTATTTGGGAGGCTGAGG + Intronic
996192506 5:120563475-120563497 CCTTCCCTTTTTAAAGGCAGAGG + Intronic
997959033 5:138304756-138304778 CCTGTCAATTTGAGAGGCTGAGG - Intronic
998684077 5:144504405-144504427 CATCTCTATTTTACAGGTTGAGG - Intergenic
999810111 5:155119420-155119442 CCTCTCTATTTTAAGGGATGTGG + Intergenic
1000651272 5:163821870-163821892 CCTCCCCTTTCCAAAGGCTGAGG + Intergenic
1001748601 5:174110916-174110938 CCTCTGCATTTTGCAGGATGGGG + Intronic
1001760507 5:174204281-174204303 CCTTTCAGTTTTAAAAGCTGAGG - Intronic
1001948610 5:175800255-175800277 CCTCCCCATTTGATAGGCAGGGG - Intronic
1003199554 6:3946704-3946726 CCTGTCCTTTATAAAGGCTGTGG - Intergenic
1004996628 6:21199560-21199582 TCCCTTCATTTTAAAGGCAGTGG + Intronic
1005992443 6:30911820-30911842 CCACTCCTTTTTAAAGGCAAAGG - Intronic
1007409492 6:41653721-41653743 CCCCACTATTTTCAAGGCTGGGG - Exonic
1007728992 6:43934410-43934432 CTTCCCCATTCTGAAGGCTGAGG - Intergenic
1008752781 6:54757416-54757438 CCTCTCCTTTCCAAAGGCAGAGG + Intergenic
1009002848 6:57741051-57741073 TTTCTGCATTTTAAATGCTGAGG - Intergenic
1009771180 6:68144816-68144838 CCTCCCCATTCCAAAGGCAGAGG + Intergenic
1010139876 6:72602030-72602052 CCTCTCCTTTCTGAAGGCAGAGG + Intergenic
1010391440 6:75342797-75342819 CCTGTGCCTTTGAAAGGCTGTGG - Intronic
1012533885 6:100272134-100272156 CCTCACCATTTTTTAGGCTCTGG + Intergenic
1013115402 6:107099983-107100005 CCTAGCCATTCTAGAGGCTGAGG - Intronic
1013467824 6:110433043-110433065 TCTGTCCATTTTACAGGTTGTGG - Intronic
1014925787 6:127267763-127267785 CCTCTGCATCTTAAAAGCTGAGG + Intronic
1014946167 6:127500690-127500712 ACTTTCCATTTTAAAGCCTGTGG - Intronic
1016951074 6:149580781-149580803 CCACTCCATTTTAAATGCTAGGG - Intronic
1017379704 6:153813988-153814010 CCTCCCCTTTTCAAAGGCAGAGG - Intergenic
1017564009 6:155664709-155664731 CCTCTCCATTTTGTAATCTGTGG + Intergenic
1017713075 6:157187188-157187210 CATCTCCAGCTTACAGGCTGGGG - Intronic
1017777372 6:157690765-157690787 CATCTCCATTTTAAAGCAGGAGG + Intergenic
1018731481 6:166654974-166654996 GGTGTCCATTTTCAAGGCTGAGG + Intronic
1019176434 6:170161593-170161615 CCTCACTATGTTAGAGGCTGTGG - Intergenic
1019835906 7:3383159-3383181 CCTGGCAATTTGAAAGGCTGAGG + Intronic
1020514227 7:9096126-9096148 CCTGTCCATTGAAAAGGCTGGGG - Intergenic
1021020348 7:15590484-15590506 ACTCTCTGTTTTAAATGCTGTGG - Intergenic
1021127521 7:16869609-16869631 CCTAGCCACTTGAAAGGCTGAGG + Intronic
1023691601 7:42794892-42794914 CCTCTCCATTTTCACGGCAGCGG - Intergenic
1024323329 7:48089928-48089950 CTTCTCCCTTTAAAAGGCGGTGG - Intronic
1025157071 7:56616714-56616736 CCCCACCATTTTAAAGGCCCTGG + Intergenic
1025184968 7:56850559-56850581 CCTCTCCATTTTACCTGCTGTGG + Intergenic
1025686966 7:63726405-63726427 CCTCTCCATTTTACCTGCTGTGG - Intergenic
1026044840 7:66899908-66899930 CCTCTCCATTTTACCTGCTGTGG - Intergenic
1027223301 7:76227719-76227741 CCTCACGTTATTAAAGGCTGTGG - Intronic
1028001420 7:85502368-85502390 CCTCCCCATTCCAAAGGCAGAGG - Intergenic
1029669758 7:102021421-102021443 CCTATCTATTTTGGAGGCTGAGG - Intronic
1031279453 7:119778871-119778893 CCTAGCTATTTGAAAGGCTGAGG - Intergenic
1031408395 7:121412681-121412703 CCTCTCCATTTTGATTTCTGAGG - Intergenic
1034045437 7:147922423-147922445 CCCCTCCTTTTGAAAGGCTCAGG + Intronic
1035405225 7:158592462-158592484 CCTCTTCAGGTTGAAGGCTGGGG + Intergenic
1036523025 8:9509867-9509889 CCTCTCCATCTTGGTGGCTGTGG + Intergenic
1036948358 8:13117218-13117240 TCCCTGCATTTGAAAGGCTGAGG + Intronic
1037176421 8:15951735-15951757 CCTCACCATTCTCAAGGCAGGGG + Intergenic
1038004504 8:23418264-23418286 TCTCTCCATTTTACAGACAGTGG + Intronic
1038746851 8:30262188-30262210 GCTCTCCATTTTATAAGCTTTGG + Intergenic
1039002284 8:32995092-32995114 CCTCCCCTTTCTAAAGGCAGAGG + Intergenic
1040743087 8:50604523-50604545 CCTCCCCTTTTTACAGGCAGGGG + Intronic
1041529152 8:58842959-58842981 CCTCCACATTTTCAAGGCTCAGG + Intronic
1041661301 8:60404136-60404158 CCTCTGGATTTTAACAGCTGTGG - Intergenic
1042402088 8:68361228-68361250 CCTCTCTATGTAAATGGCTGTGG - Intronic
1046211294 8:111080628-111080650 CCTCCCCATTCTAAAGGAAGAGG + Intergenic
1046268140 8:111858552-111858574 CCTCACCTTTTCAAAGGCAGAGG + Intergenic
1047801981 8:128319327-128319349 CCTATCCACTTGAGAGGCTGGGG + Intergenic
1049079203 8:140428568-140428590 TCTCTTCATTTTACAGGCAGGGG - Intronic
1049141583 8:140959898-140959920 CCTCGCTACTTGAAAGGCTGAGG + Intronic
1051930532 9:22380152-22380174 CCTTTCGAATTTAAAGGCTCAGG - Intergenic
1051966596 9:22836008-22836030 CCTCTCCTTTTCACAGGCAGAGG + Intergenic
1052428050 9:28330251-28330273 TCTCACAATTTTAGAGGCTGAGG - Intronic
1052848310 9:33357645-33357667 CCTATCTATTTTGGAGGCTGAGG - Intronic
1052882233 9:33608887-33608909 CCTCTGCATTTTATAAGTTGAGG - Intergenic
1053000545 9:34575098-34575120 CCTCTCCATTCAAGAGGCAGGGG - Intronic
1054888985 9:70231558-70231580 CCCCGCTATTTGAAAGGCTGAGG - Intergenic
1055013656 9:71593425-71593447 CCTCTCCAATTTCAAGGCCATGG + Intergenic
1056449766 9:86705538-86705560 CCTCTGCAATGTAAAGGGTGGGG + Intergenic
1058382398 9:104391904-104391926 CATCTCCATTTTACAGATTGAGG - Intergenic
1058443263 9:105030095-105030117 CCTATCACTTTGAAAGGCTGAGG - Intergenic
1059728119 9:117028872-117028894 CCTCTCCATTTAAGATACTGGGG + Intronic
1060497003 9:124126265-124126287 CATCTCCATTTTACAGGTGGGGG - Intergenic
1061915533 9:133751257-133751279 CCTCTCCTTTCCAAAGGCAGAGG + Intergenic
1186024038 X:5288910-5288932 CCTCTCACTTTGAGAGGCTGAGG + Intergenic
1186129221 X:6448370-6448392 TCTTTCCATTTTAAAGGCCATGG + Intergenic
1186367499 X:8910820-8910842 CATTTCCATTTTCAAGGCAGTGG - Intergenic
1186535703 X:10345462-10345484 CCTGTCCATTTTACAGGCCATGG + Intergenic
1188637641 X:32454203-32454225 TCTATCCATATTAAAGGCTACGG + Intronic
1188715671 X:33456747-33456769 CCTCTCCTTTCCAAAGGCAGAGG - Intergenic
1189690513 X:43612857-43612879 CCTCCCCTTTTCAAAGGCAGAGG + Intergenic
1189835196 X:45013232-45013254 CCTCTCAATCTTAAAACCTGGGG - Intronic
1190465914 X:50724943-50724965 CCTCTCCCATTTAAAGTCTCTGG + Intronic
1191231415 X:58099013-58099035 TCTCTCCATTTGAATGCCTGGGG - Intergenic
1192119575 X:68442220-68442242 CCCAGCCATTTTAGAGGCTGAGG - Intergenic
1192812612 X:74560373-74560395 CCTCCCCTTTCTAAAGGCAGAGG - Intergenic
1193243029 X:79195065-79195087 CCTCCCCATTTCAAAGGCAGAGG - Intergenic
1193409065 X:81141069-81141091 CCTCTCCTTTTCAAAGGCAGAGG - Intronic
1194265006 X:91743103-91743125 CCTCTCCTTTCCAAAGGCAGAGG + Intergenic
1194481058 X:94424796-94424818 CCTCTCCTTTCCAAAGGCAGAGG + Intergenic
1194591565 X:95805776-95805798 CCTCTCCTTTTCAAAGGCAGAGG - Intergenic
1195343927 X:103929510-103929532 CCTCTCACTTCTCAAGGCTGTGG + Intronic
1195363061 X:104103822-104103844 CCTCTCACTTCTCAAGGCTGTGG - Exonic
1195892533 X:109711479-109711501 CCCCTCCATTTTTATGGTTGTGG - Intronic
1197028287 X:121782343-121782365 CCTCTCCTTTCCAAAGGCAGGGG + Intergenic
1197363163 X:125532465-125532487 CCTCCCCTTTTCAAAGGCAGAGG + Intergenic
1198308059 X:135402075-135402097 CCTGTCCATTTTCAAGTCTTTGG - Intergenic
1198802211 X:140459552-140459574 ATTCTCCATCATAAAGGCTGCGG - Intergenic
1198870243 X:141171406-141171428 CCTCTCCATTTTATATGGTTTGG + Intergenic
1199308637 X:146297225-146297247 CCTCTCCTTTCTAAAGGCAGAGG + Intergenic
1200582156 Y:4963549-4963571 CCTCTCCTTTCCAAAGGCAGAGG + Intergenic
1200854984 Y:7928069-7928091 TCTCAGCATTTTAAAGGCTGAGG + Intergenic
1200870389 Y:8091841-8091863 TCACTCCATTGTAAAGGCTCAGG + Intergenic
1202017015 Y:20420220-20420242 TCTCTCCTTTTCAAAGGCAGAGG + Intergenic
1202264483 Y:23003556-23003578 TTTCAGCATTTTAAAGGCTGAGG - Intronic
1202417474 Y:24637298-24637320 TTTCAGCATTTTAAAGGCTGAGG - Intronic
1202453312 Y:25032788-25032810 TTTCAGCATTTTAAAGGCTGAGG + Intronic