ID: 922537493

View in Genome Browser
Species Human (GRCh38)
Location 1:226391835-226391857
Sequence TTGATTAAACAGAAGGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922537489_922537493 -4 Left 922537489 1:226391816-226391838 CCTGGTTAATGAAGTTCCTTTGA 0: 1
1: 0
2: 0
3: 14
4: 117
Right 922537493 1:226391835-226391857 TTGATTAAACAGAAGGCTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 261
922537485_922537493 24 Left 922537485 1:226391788-226391810 CCTTCAAGGGCTAGAACTGGTGG No data
Right 922537493 1:226391835-226391857 TTGATTAAACAGAAGGCTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922537493 Original CRISPR TTGATTAAACAGAAGGCTGG AGG Intronic
902645565 1:17795668-17795690 GAAATTAAACAGAAGGGTGGGGG + Intronic
904336463 1:29801372-29801394 TAAATTAAACACAATGCTGGAGG - Intergenic
905156067 1:35983237-35983259 TTGATTAAACAAATGGCAGCTGG + Intronic
905721067 1:40202488-40202510 TTGATAAAGCAGTAGCCTGGGGG - Exonic
906984099 1:50664495-50664517 ACAACTAAACAGAAGGCTGGGGG + Intronic
908711881 1:67024746-67024768 TTGCTTAAAAAAAAGGTTGGGGG - Intronic
909865949 1:80671810-80671832 TGTATTAATCAGAAGGCTAGTGG - Intergenic
909867468 1:80692289-80692311 TTGACTAAACAGCAGACTGTGGG + Intergenic
911281175 1:95931124-95931146 TTATTTACACAAAAGGCTGGAGG - Intergenic
911575132 1:99567151-99567173 TGGATTAAACAGTAGAATGGAGG + Intergenic
912670086 1:111617418-111617440 TTGATGACACAGAAGGCAAGAGG - Intronic
912722736 1:112033776-112033798 TTTATTAAACAGAACTCTGTTGG - Intergenic
913602875 1:120438922-120438944 TTGATTATACTGAATGCTGCTGG - Intergenic
913603623 1:120445275-120445297 TTGATTATACTGAATGCTGCTGG - Intergenic
913640483 1:120807989-120808011 TTGATTATACTGAATGCTGCTGG - Intronic
914277997 1:146142352-146142374 TTGATTATACTGAATGCTGCTGG + Intronic
914487631 1:148124601-148124623 TTGATTATACTGAATGCTGCTGG + Intronic
914539043 1:148593300-148593322 TTGATTATACTGAATGCTGCTGG + Intronic
914627636 1:149478324-149478346 TTGATTATACTGAATGCTGCTGG - Intergenic
915406984 1:155667528-155667550 TAAATAAAAAAGAAGGCTGGGGG + Intronic
915526559 1:156479793-156479815 TTGACTAGACAGAAAGATGGAGG + Exonic
915578278 1:156796012-156796034 TTGTTTTAACTGAATGCTGGCGG + Intronic
916172170 1:162009660-162009682 CTGAATAAACAAGAGGCTGGCGG + Intronic
917384381 1:174453962-174453984 TTGGTTAAAAAGAATGCTGAAGG + Intronic
919032463 1:192260581-192260603 TGAATTAAACAAATGGCTGGAGG + Intergenic
919737845 1:200964639-200964661 CTGCTTAAACAGAATGCTGTAGG + Intergenic
920783348 1:209015910-209015932 TTGGTGAAACATGAGGCTGGAGG + Intergenic
921221594 1:212977748-212977770 TTGTTGAAACAGAAGACTGCTGG + Intronic
922238203 1:223737146-223737168 TTGACTAAGCATAAGGCTCGTGG + Intronic
922537493 1:226391835-226391857 TTGATTAAACAGAAGGCTGGAGG + Intronic
922663032 1:227446962-227446984 AAGAGCAAACAGAAGGCTGGGGG - Intergenic
1064157873 10:12918702-12918724 GTGATTAAACAGATGGAAGGGGG + Intronic
1064454860 10:15477996-15478018 TTGAATGAACTGAAGGCTGTGGG + Intergenic
1064583744 10:16818842-16818864 ATGATTAAAAATAATGCTGGGGG + Intergenic
1064806215 10:19137059-19137081 TTGATTAAAGAGAAGATGGGTGG + Intronic
1067321592 10:45225853-45225875 ATGATTAAAAATAATGCTGGGGG + Intergenic
1067926115 10:50509649-50509671 TTTGTTAAACAGAATGCTGCTGG - Intronic
1068913161 10:62400304-62400326 TTGATTAACCAGAATACTCGGGG - Intronic
1069513728 10:69060980-69061002 TGTATTAAAAAGAGGGCTGGAGG - Intergenic
1071449071 10:85777321-85777343 TTGAGTGGACAGTAGGCTGGAGG - Intronic
1071902460 10:90135864-90135886 TTGCTTATACTGAAGTCTGGAGG - Intergenic
1073281992 10:102361249-102361271 TTGATTGAACCGAACTCTGGAGG - Intronic
1073899012 10:108197534-108197556 TTGATAAAACAAAAGGTAGGAGG - Intergenic
1074596236 10:114870148-114870170 TTGATTACACAGATCACTGGAGG - Intronic
1075529230 10:123213440-123213462 TTGAGCAGACAGAATGCTGGGGG + Intergenic
1075944392 10:126419637-126419659 ATGATTCAAGAGAAGGCTGAGGG + Intergenic
1076303234 10:129443831-129443853 TTAATTAAAAAGTAAGCTGGTGG + Intergenic
1077670679 11:4154560-4154582 TTGGTCAAGCAGAAGGCTTGGGG - Intergenic
1077816060 11:5686312-5686334 TTCATGAAACAGAAAGCTGCGGG - Intronic
1079951576 11:26811819-26811841 TTAATTAAACAAAAGCATGGAGG + Intergenic
1080907474 11:36561102-36561124 TGGATTAAACTGGAAGCTGGAGG + Intronic
1083550293 11:63583525-63583547 ATGATTAAACACAAGACTGTTGG + Intronic
1087008700 11:93493561-93493583 TTGAGGAATCAGGAGGCTGGAGG - Intronic
1088100099 11:106145232-106145254 TTGTTTAAAAAGAAGGATGTTGG + Intergenic
1088299776 11:108344701-108344723 CTGATTAAAAATAAGGTTGGGGG + Intronic
1090869195 11:130727792-130727814 TTGATAAAGCAGCAGGCTGATGG + Intergenic
1090956053 11:131513698-131513720 TTGATTATACAGGGGCCTGGTGG + Intronic
1093077336 12:14771444-14771466 TTGAAAAAACAGAAGGAGGGAGG - Intergenic
1093331478 12:17848340-17848362 ATGAGAAAACAGAAGGCTAGAGG + Intergenic
1094476422 12:30844088-30844110 TTGGTTATACGGGAGGCTGGAGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097243528 12:57592150-57592172 TTGACCAAAGAGAAGGCTGAGGG + Intronic
1097605990 12:61755075-61755097 CTAATTAAAAAGAAGGGTGGGGG - Intronic
1098537405 12:71608950-71608972 TTAATCAAAAAGAAAGCTGGAGG - Intergenic
1098784200 12:74728980-74729002 TTAATTAAAAATAAGGCAGGAGG - Intergenic
1100315372 12:93441087-93441109 TAGTTTTAACACAAGGCTGGGGG - Intronic
1104260165 12:127174890-127174912 TTGATTAAGCAGCAGGCACGGGG + Intergenic
1104437439 12:128767090-128767112 TTAATTAGAAAGAAAGCTGGGGG + Intergenic
1106831857 13:33592904-33592926 TAGATTATAAAGAAGGCAGGAGG + Intergenic
1108506362 13:51116143-51116165 TTGAGTACACAAAGGGCTGGTGG + Intergenic
1109838390 13:67888882-67888904 ATGATTTGACAGAGGGCTGGAGG - Intergenic
1110721884 13:78770981-78771003 TTGCTTAAAAAGCAGTCTGGTGG + Intergenic
1112199434 13:97260752-97260774 GTGGTTAAACAGAGGCCTGGTGG + Intronic
1112293473 13:98165509-98165531 TTGTTTTAACAGAAGGCCGTGGG + Intronic
1112699895 13:101995424-101995446 TTGATGAAACAGGAGTGTGGCGG + Intronic
1114918692 14:27298440-27298462 TGGCTGAAACAGTAGGCTGGTGG - Intergenic
1116462893 14:45198052-45198074 CAAATTAAAAAGAAGGCTGGTGG - Intronic
1116709101 14:48342489-48342511 TTTATTAAAGAGAATACTGGAGG + Intergenic
1117792011 14:59351070-59351092 TTGAAGGAAGAGAAGGCTGGAGG - Intronic
1120333223 14:83120351-83120373 ATGATGAAACGGAAGGCTGTTGG - Intergenic
1123022636 14:105408811-105408833 CTGAGTAGACAGAATGCTGGTGG - Intronic
1202845442 14_GL000009v2_random:168768-168790 TTGCTTATACAGAAGAATGGAGG - Intergenic
1202914841 14_GL000194v1_random:159034-159056 TTGCTTATACAGAAGAATGGAGG - Intergenic
1202875350 14_GL000225v1_random:202451-202473 TTGCTTATACAGAAGAATGGAGG + Intergenic
1202877828 14_KI270722v1_random:23675-23697 TTGCTTATACAGAAGAATGGAGG + Intergenic
1125083964 15:35708207-35708229 TTTATTGAACAGATGTCTGGAGG + Intergenic
1127459867 15:59188827-59188849 TTGGTTAATCAGAAGGCTAAAGG + Intronic
1127553735 15:60066694-60066716 TTCATTGCACAGAAGACTGGAGG + Intergenic
1129270178 15:74415384-74415406 TTGATTGAACACACGGCAGGCGG - Intronic
1130393229 15:83478102-83478124 TTCATTAAACCGAAAGCTGAAGG + Intronic
1130793172 15:87178428-87178450 TTGAGTGAACAGATGGCTGCAGG - Intergenic
1131393807 15:92070696-92070718 TTGCTTTAACATAAGGATGGAGG + Intronic
1131561963 15:93451654-93451676 CTGATTCAACATAACGCTGGTGG - Intergenic
1131763325 15:95648128-95648150 ATAATAAAACAGACGGCTGGTGG + Intergenic
1131967352 15:97858539-97858561 CTGACAAAACAGAAGGCAGGAGG + Intergenic
1135250730 16:20899797-20899819 ATGATTAAAGAGAACGATGGGGG + Intronic
1135569299 16:23535996-23536018 TTGATTCTGCACAAGGCTGGAGG - Intronic
1137229346 16:46548819-46548841 TGGAATAAACAGAAGGCCAGTGG - Intergenic
1137290143 16:47046914-47046936 TTGATTCATCAGAAGGCTCCAGG - Intergenic
1137840364 16:51635842-51635864 AGGTTGAAACAGAAGGCTGGTGG + Intergenic
1137989730 16:53141851-53141873 TTTATTAAGAGGAAGGCTGGTGG + Intronic
1138810330 16:60141471-60141493 TTGAAAAAAAAGAAGGATGGAGG + Intergenic
1139760754 16:69182963-69182985 TTGATTTAGGAGAGGGCTGGAGG + Intronic
1140546966 16:75819996-75820018 CTGATTAAACTGAATGCTGATGG + Intergenic
1142751535 17:1991402-1991424 TCGATTAAAAAGAAAGTTGGGGG - Intronic
1145046205 17:19618787-19618809 TTGAATTAACAGAAGCCTGAAGG + Intergenic
1145372296 17:22316951-22316973 TTAATTAAACCAAAAGCTGGAGG + Intergenic
1147619886 17:41858873-41858895 TTCATTTAAGAGGAGGCTGGTGG - Intronic
1148989020 17:51649239-51649261 TTGATGAATCAGAAACCTGGAGG + Exonic
1151472092 17:74325056-74325078 TTTATTAAACCCAAGGCTGACGG + Intergenic
1151542246 17:74770448-74770470 TTCATTAACCTGAAGACTGGTGG + Intergenic
1153010133 18:531185-531207 TTGAGCAAACCGAAGGCTGTAGG + Intergenic
1156863312 18:41863105-41863127 TTGATAAAGAAGAAGCCTGGAGG - Intergenic
1157059836 18:44275323-44275345 TTGATTCAACCGAATGTTGGCGG - Intergenic
1158342828 18:56485140-56485162 TAAATTAAACATAAAGCTGGGGG + Intergenic
1159571706 18:70121330-70121352 TTTATTAAACACAAGACTGTAGG + Intronic
1160153526 18:76413409-76413431 TTGATTGAACAGACGTCTGTTGG - Intronic
1160210358 18:76873496-76873518 TGGTTTAAACAGGAGGCTGGCGG + Intronic
1161351087 19:3792170-3792192 TTGATCACACAGCTGGCTGGGGG + Intronic
1161650080 19:5478941-5478963 TTGATTTAACTGAGGGCTGCTGG - Intergenic
1168389633 19:55995531-55995553 TTGAGCAAAAAGAAAGCTGGAGG - Intergenic
1202672850 1_KI270710v1_random:9268-9290 TTGCTTATACAGAAGAATGGAGG - Intergenic
925681549 2:6427404-6427426 TTGATTAGACATCAGGGTGGGGG + Intergenic
927810357 2:26177133-26177155 ATGATGAAACGGAAGGCTTGGGG + Intronic
929351438 2:40960610-40960632 TGGATTTAAGAGAAAGCTGGAGG - Intergenic
929663573 2:43815095-43815117 GTGATTAAACAGAAAGTTGAAGG + Intronic
930667909 2:54117599-54117621 TTTATTAATGAGAAGACTGGGGG + Intronic
932119625 2:69086621-69086643 ATGATTAAGCAGAAGGCCAGGGG + Intronic
932329990 2:70893046-70893068 TTGAGGAGATAGAAGGCTGGGGG + Intergenic
933346926 2:81099019-81099041 CTGATCAAAAAGAAAGCTGGAGG - Intergenic
934161278 2:89252122-89252144 ATAAGTAAACAGAAGGCTTGAGG + Intergenic
934206001 2:89930293-89930315 ATAAGTAAACAGAAGGCTTGAGG - Intergenic
938341884 2:130541311-130541333 TTGATTGCACAGATGGCAGGAGG - Intronic
938347946 2:130579400-130579422 TTGATTGCACAGATGGCAGGAGG + Intronic
941211120 2:162641019-162641041 TTGATAAAACCAAATGCTGGTGG + Intronic
942061255 2:172230682-172230704 TTGATTACACATGAGGATGGAGG + Intergenic
946015606 2:216601790-216601812 TTGTTGAAACAGATTGCTGGTGG - Intergenic
946997919 2:225416939-225416961 ATGATTAAACAGAAGCCCGTTGG + Intronic
948285622 2:236782470-236782492 TTGACTAAACAGATTGCTGATGG - Intergenic
948471307 2:238182074-238182096 ATGAGGATACAGAAGGCTGGAGG - Exonic
1169931885 20:10842545-10842567 TTTATTTCACAGAAGCCTGGTGG - Intergenic
1170264848 20:14454519-14454541 TTGCATAAACAGAAGTCTGGTGG + Intronic
1172536374 20:35676653-35676675 TGGATAAAAAAGAAAGCTGGAGG + Intronic
1173213311 20:41055081-41055103 TTGATAAAACAGAAGACTTATGG - Intronic
1173588690 20:44206598-44206620 TTGATTAAAAAGAAGTGGGGGGG + Intronic
1173904484 20:46616224-46616246 TTGCTTGAACAAAGGGCTGGGGG - Intronic
1174409246 20:50322844-50322866 TTGAATAGATAGAAGGCAGGAGG - Intergenic
1176634192 21:9173679-9173701 TTGCTTATACAGAAGAATGGAGG - Intergenic
1176639116 21:9281110-9281132 TTGCTTATACAGAAGAATGGAGG + Intergenic
1177485624 21:21751633-21751655 TTAATTAATCAGAAACCTGGGGG - Intergenic
1178079923 21:29052719-29052741 TTGAATAAATAGAAGACTTGTGG + Intronic
1180372422 22:12053953-12053975 TTGCTTATACAGAAGAATGGAGG + Intergenic
1180390044 22:12221699-12221721 TTGCTTATACAGAAGAATGGAGG - Intergenic
1180415892 22:12712770-12712792 TTGCTTATACAGAAGAATGGAGG + Intergenic
1180423162 22:12888617-12888639 TTGCTTATACAGAAGAATGGAGG + Intergenic
1182574935 22:31266648-31266670 CTGAGTGAACAGAAGTCTGGGGG - Intronic
1182676723 22:32044718-32044740 TTGAGTAAACTGGAGGCTGAGGG - Intronic
950114969 3:10444829-10444851 TTCATGAGACAGAAGGCTGCAGG - Intronic
950928736 3:16768459-16768481 TTCCTTTAACAGCAGGCTGGTGG - Intergenic
951589229 3:24245204-24245226 TTGATGAAACAGAGGGCCAGAGG + Intronic
955194919 3:56796357-56796379 TGGTTTACACAGAAGGCTTGTGG + Intronic
955778069 3:62454926-62454948 TTTATTAAACAAAGGGCTGCTGG + Intronic
957848968 3:85780342-85780364 TTGATTCAACAGAAAGATTGAGG - Intronic
960275334 3:115722408-115722430 TTAATTAAACAAAAGCCTGGGGG - Intergenic
962719840 3:138162955-138162977 TTGATTAAAAACAAAGGTGGAGG + Intronic
963466847 3:145692858-145692880 TTGAAAACACAGAAGGGTGGAGG + Intergenic
964396849 3:156254814-156254836 TTGATGTTACAGAAGACTGGAGG - Intronic
964542649 3:157796734-157796756 ATGATTAAAAATAAGGCTGTGGG - Intergenic
966137631 3:176718021-176718043 TAGATAAAACAGAGGCCTGGAGG + Intergenic
966566597 3:181389407-181389429 TTGAATAAAAACAAAGCTGGAGG - Intergenic
1202747779 3_GL000221v1_random:123909-123931 TTGCTTATACAGAAGAATGGAGG - Intergenic
968644762 4:1734900-1734922 TTGATTAAAACTAAGGGTGGAGG - Intronic
969567737 4:7989417-7989439 TTGATTAAATACAAGTATGGTGG - Intronic
970994171 4:22246906-22246928 TTGATTAAACAAATGGGTGATGG - Intergenic
971495820 4:27264147-27264169 TAGATTAAACAGAAGGTTATGGG + Intergenic
973595399 4:52483547-52483569 GTAATTAAACATAAGGCTGTTGG - Intergenic
973686650 4:53377453-53377475 GTTATTAAAAAGAAGGGTGGGGG + Intergenic
973952942 4:56036033-56036055 TGGAGTAAACAGAAGACTGATGG - Intergenic
975110189 4:70614726-70614748 TTAATTAAACAGGTGGGTGGGGG + Intergenic
976960965 4:90972714-90972736 TTGAGTAAGAAGAAAGCTGGAGG + Intronic
977121384 4:93106032-93106054 GTTATTAAACATAAGACTGGGGG - Intronic
978286156 4:107079509-107079531 TTGAATAAACAGAAGGAATGTGG - Intronic
979026541 4:115584537-115584559 ATGAATAAACAGAAGGCTAGTGG - Intergenic
979267882 4:118724832-118724854 TTAATTACACAGGAGGCAGGTGG - Intronic
979394845 4:120175064-120175086 TTGATGAAATAAAAGGCTGGAGG - Intergenic
979475368 4:121150632-121150654 ATGATGAATCAGTAGGCTGGAGG + Intronic
979938227 4:126724551-126724573 TTTATTAGACAGATGCCTGGAGG - Intergenic
980186314 4:129465305-129465327 CTGATTATACATAATGCTGGTGG + Intergenic
985043387 4:185915710-185915732 TTCATTAAACTTAATGCTGGGGG - Intronic
987627866 5:20425881-20425903 TTGATAAAACAGATGGTTGTAGG + Intronic
987788175 5:22528824-22528846 ATTAGTAAAGAGAAGGCTGGTGG - Intronic
988433684 5:31149031-31149053 TTGATTAATCAGATGGCTTTGGG + Intergenic
990015869 5:51062342-51062364 TTGATCAAAAAGAAAGCTGGAGG - Intergenic
991400548 5:66246599-66246621 TTGTTAAAGAAGAAGGCTGGTGG + Intergenic
993033343 5:82729564-82729586 ATGATTCCACACAAGGCTGGAGG - Intergenic
993720168 5:91314411-91314433 TTATTTAAACAGAAGGCTCCAGG - Intergenic
995703255 5:114958879-114958901 TTGATTAAATAAAAAGGTGGAGG - Intergenic
995994633 5:118283316-118283338 TTTGTTAAACAGACGGTTGGAGG + Intergenic
1000712077 5:164592802-164592824 TTGATAAAATAGAAGGATGAAGG + Intergenic
1002985047 6:2181498-2181520 TTTAATAAACTGAAGGCTTGTGG + Intronic
1003079025 6:3006121-3006143 TAGATCGAGCAGAAGGCTGGGGG - Intronic
1004624979 6:17366274-17366296 TTGATTAAAAACAAAGTTGGAGG - Intergenic
1005430758 6:25754362-25754384 TCTATTAAACAGCAGGATGGTGG + Intergenic
1005598210 6:27399406-27399428 ATGATTTAACACAAGGCTGCTGG - Intronic
1005714050 6:28530173-28530195 TTGATTAGAGTGAGGGCTGGCGG + Intronic
1005795667 6:29359446-29359468 TTGAACAAGCAGATGGCTGGGGG + Intronic
1006014897 6:31072635-31072657 CTGATTAAACATGAGGCTGAGGG + Intergenic
1007019977 6:38509873-38509895 TTGATGAAACATGAAGCTGGGGG - Intronic
1007092429 6:39192535-39192557 TGGATTACAAACAAGGCTGGTGG + Intronic
1007612258 6:43157996-43158018 TTAATTAAAAAGTAAGCTGGGGG + Intronic
1009451678 6:63808456-63808478 TAGATTAGACAGAGAGCTGGAGG + Intronic
1012735357 6:102932751-102932773 TTTAATAAAAAGAAAGCTGGAGG + Intergenic
1013571864 6:111435361-111435383 TTGAGCAAAAAGAAAGCTGGAGG + Intronic
1014109635 6:117606011-117606033 TTGATTAAATAAAATGCTAGTGG - Intergenic
1014126903 6:117786679-117786701 TTGCTTAACAAGAAGTCTGGAGG - Intergenic
1014693767 6:124593861-124593883 TTGCCAAAACAGAAGCCTGGAGG - Intronic
1014871941 6:126607214-126607236 TTGATTAAAAACAAAGTTGGTGG - Intergenic
1015075552 6:129152308-129152330 TTGATAACACACAAGGTTGGTGG + Intronic
1015594328 6:134851737-134851759 GTGAGTTAACAGAAGGCAGGCGG + Intergenic
1017764523 6:157595811-157595833 TTGATTTACCAGAAAGGTGGAGG - Intronic
1017848707 6:158283747-158283769 CTGCTGAAGCAGAAGGCTGGAGG - Intronic
1019791561 7:3017293-3017315 TAGATCAAACAGGACGCTGGAGG + Intronic
1020188006 7:5973709-5973731 CTGATTTCACAGAAGGGTGGAGG - Intronic
1020294912 7:6751060-6751082 CTGATTTCACAGAAGGGTGGAGG + Intergenic
1022215309 7:28254200-28254222 TTGATTACAAAGGAGGCTGGGGG - Intergenic
1024765692 7:52655713-52655735 TTGATCAAACAAAAGTGTGGAGG - Intergenic
1026131836 7:67627380-67627402 TTGAGAAAACAGAAGTATGGAGG + Intergenic
1026688722 7:72534347-72534369 GTGATTCATCAGAATGCTGGGGG + Intergenic
1026723953 7:72856244-72856266 GTGATTCATCAGAATGCTGGGGG + Intergenic
1030957150 7:115868391-115868413 GTGAGTAACCAGAAGTCTGGGGG + Intergenic
1032116296 7:129120512-129120534 TTGAGCAAAAAGAAAGCTGGAGG - Intergenic
1032287132 7:130547726-130547748 TTGGTTATAAGGAAGGCTGGGGG + Exonic
1032324093 7:130910293-130910315 TTTATTCCACACAAGGCTGGAGG - Intergenic
1032489906 7:132316824-132316846 TTGATGAAACTGGAGGGTGGGGG - Intronic
1032700706 7:134376426-134376448 TTGGTTTACCAGATGGCTGGTGG + Intergenic
1032903450 7:136337342-136337364 TTCATTAACCAGAAGACTGATGG - Intergenic
1034776764 7:153834677-153834699 TTGAGTAAACTGAAGTCAGGAGG + Intergenic
1035169394 7:157009368-157009390 ATGATTAACCCGAAGGCTGCAGG - Intronic
1036674821 8:10821842-10821864 TTGACTAAAAGGAATGCTGGAGG + Intronic
1040611354 8:48985715-48985737 TTGATAAATGAGAAGTCTGGAGG + Intergenic
1045419372 8:101998924-101998946 TTGCTAAAAGAGAAGGCTAGTGG - Intronic
1045751886 8:105495134-105495156 TTTGATAAACAGAAGACTGGTGG - Intronic
1047264481 8:123293175-123293197 TTCATTCAACAGAAAACTGGTGG - Intergenic
1050920918 9:11199554-11199576 CTGCTTAAGCAGCAGGCTGGGGG + Intergenic
1051617211 9:19017635-19017657 TTGTTTAAGCAAAAGGCTGTGGG - Intronic
1051648600 9:19296256-19296278 ATGATTAGAAAGATGGCTGGTGG + Intronic
1052302185 9:26964661-26964683 TTGATTGGACATAAGGCTTGTGG - Intronic
1053311225 9:37021672-37021694 TTGATGTAAGAGAAGGGTGGAGG - Intronic
1054978794 9:71179788-71179810 TTGTTTAAACAGAATGTTTGTGG - Intronic
1054987580 9:71280332-71280354 TTGTTTAAACAGAATGTTTGTGG + Intronic
1056297647 9:85208448-85208470 TTCATTAAACTGCAGGTTGGTGG - Intergenic
1056950231 9:91035819-91035841 TAGATTATACAGCAGGCAGGAGG - Intergenic
1060464855 9:123894503-123894525 TTGATAAAACAAAATGCTGTGGG + Intronic
1203757031 Un_GL000218v1:141315-141337 TTGCTTATACAGAAGAATGGAGG - Intergenic
1203716414 Un_KI270742v1:153990-154012 TTGCTTATACAGAAGAATGGAGG - Intergenic
1203534800 Un_KI270743v1:24249-24271 TTGCTTATACAGAAGAATGGAGG + Intergenic
1203650642 Un_KI270751v1:117545-117567 TTGCTTATACAGAAGAATGGAGG - Intergenic
1185681902 X:1895945-1895967 TTGGTTAAACAGAAGACAAGAGG - Intergenic
1186697411 X:12051749-12051771 TTGAATAAACAGATGGATGGAGG - Intergenic
1186954298 X:14664795-14664817 CTCTTTAAAGAGAAGGCTGGAGG + Intronic
1187072955 X:15906781-15906803 TTGATTAAAGAGGTGCCTGGAGG - Intergenic
1189093217 X:38109713-38109735 TAGAACAAGCAGAAGGCTGGAGG + Intronic
1191832596 X:65431021-65431043 TTGATAAAACAGAGGAATGGGGG - Intronic
1198328925 X:135603347-135603369 ATGATTAATCAGAATGCTTGGGG + Intergenic
1198894904 X:141443013-141443035 TTTATTAAATATCAGGCTGGTGG - Intergenic
1199641326 X:149865102-149865124 TTGAATAAAGTGAGGGCTGGAGG + Intergenic
1201170612 Y:11258939-11258961 TTGCTTATACAGAAGAATGGAGG - Intergenic
1201319979 Y:12687824-12687846 TTTATAAAAGAAAAGGCTGGGGG + Intergenic