ID: 922537576

View in Genome Browser
Species Human (GRCh38)
Location 1:226392531-226392553
Sequence CCTGATATGCTGCTCTTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922537576_922537584 24 Left 922537576 1:226392531-226392553 CCTTGAAAGAGCAGCATATCAGG 0: 1
1: 0
2: 1
3: 15
4: 160
Right 922537584 1:226392578-226392600 ATCTCCTCCCCTTTCTCTGGAGG 0: 1
1: 0
2: 3
3: 35
4: 341
922537576_922537582 21 Left 922537576 1:226392531-226392553 CCTTGAAAGAGCAGCATATCAGG 0: 1
1: 0
2: 1
3: 15
4: 160
Right 922537582 1:226392575-226392597 TCCATCTCCTCCCCTTTCTCTGG 0: 1
1: 1
2: 5
3: 71
4: 553

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922537576 Original CRISPR CCTGATATGCTGCTCTTTCA AGG (reversed) Intronic
903916862 1:26771192-26771214 CTGGATATACTGCTTTTTCAAGG - Exonic
904359310 1:29961680-29961702 CCTTACATGATGCTCTCTCAGGG - Intergenic
907230451 1:52993559-52993581 CCTCATATACTGTTCTCTCATGG + Intronic
907411531 1:54286973-54286995 TCTGAGATGCTTCTCTCTCAGGG - Intronic
907592581 1:55689973-55689995 CCTTATCTGCTCCTCTCTCAGGG - Intergenic
908409145 1:63845277-63845299 CCTGAGTAGCTGTTCTTTCAGGG - Intronic
908772376 1:67608843-67608865 CCTGAGATGCTGCTTTTCCCAGG - Intergenic
912045115 1:105444139-105444161 CCTGATATGATGCAATTACATGG + Intergenic
912415574 1:109506350-109506372 CCTAATATGCTGCTCTGTAAAGG - Exonic
912650520 1:111434733-111434755 CCAGATGTGCTGTTCTTTAATGG + Intergenic
913311364 1:117499289-117499311 CTTCATATTCTGTTCTTTCAGGG + Intronic
915028785 1:152858338-152858360 CCTGCTCTGCTGCTCTTTCTGGG - Intergenic
918114483 1:181484685-181484707 CCTGATGAGCTGCTCTTTCTTGG - Intronic
918668853 1:187187397-187187419 CATGATATCCTTCTTTTTCATGG - Intergenic
918775872 1:188629410-188629432 CCTGATTTGCTGTGCTTTCCTGG - Intergenic
922017400 1:221664481-221664503 GCTGCTAGGCTGCTATTTCATGG + Intergenic
922537576 1:226392531-226392553 CCTGATATGCTGCTCTTTCAAGG - Intronic
924397319 1:243635804-243635826 CCTGATATGTTGCTCTGAGAAGG + Intronic
1063049610 10:2432927-2432949 CCTGCTGAGCTGCCCTTTCAAGG + Intergenic
1063320254 10:5045685-5045707 CCTGCTTTGCAGGTCTTTCAGGG + Intronic
1063931989 10:11037811-11037833 CATGATATGCTTCTAGTTCATGG + Intronic
1066696662 10:38085088-38085110 CCTTAAATGTTGCTCTATCAAGG + Intergenic
1067246438 10:44550536-44550558 CTTGCTAGGCTGCTCCTTCATGG + Intergenic
1072797317 10:98365927-98365949 CCTGCTGTGCTTCTATTTCAGGG - Intergenic
1074489807 10:113929539-113929561 GCTGATATGCTTCTAATTCAGGG + Intergenic
1078765645 11:14294807-14294829 CCTCATATACTGTTCTCTCATGG + Exonic
1081210518 11:40328142-40328164 CTTGATATTCTACTCTTCCATGG + Intronic
1082705382 11:56488097-56488119 GCTGAAATCCTGCTCTTTTATGG - Intergenic
1082915858 11:58436048-58436070 CCAAATATGCTCCTCTTTCATGG - Intergenic
1084930596 11:72552727-72552749 CCAGATCTGGTCCTCTTTCATGG + Intergenic
1085125962 11:74002615-74002637 ACTTATCTGCTGCTCTTTGAGGG + Intronic
1087229809 11:95647854-95647876 CCTGACATGATGCTCAGTCAAGG - Intergenic
1088835789 11:113577109-113577131 CCTGCTGTGCTGCTCTGTCTAGG + Intergenic
1090767264 11:129887071-129887093 CCAGATGTGCTGCCCATTCAGGG + Intronic
1093857783 12:24126795-24126817 TCTAGTATGCTGCTCTTTCTGGG + Intergenic
1094224032 12:28025909-28025931 TCTGCTATGCTGCTCTGTCAGGG - Intergenic
1098389243 12:69951728-69951750 CCTAATCTTCTGCTCTTACACGG + Intronic
1101728209 12:107405355-107405377 CCTGATAGGTTGCTATTTAATGG - Intronic
1102569598 12:113819379-113819401 CCTGTTATGGTTCTCTTTCCCGG + Intronic
1110675971 13:78244874-78244896 AGTGGCATGCTGCTCTTTCAGGG - Intergenic
1112032907 13:95473746-95473768 CCTGCTATGCTGCTGGTTCAGGG + Intronic
1113964381 13:114144425-114144447 CCTGAGATGTGGCTCTGTCAAGG + Intergenic
1115869814 14:37786992-37787014 CGTGAAAGTCTGCTCTTTCACGG - Intronic
1115942696 14:38627270-38627292 CCTGATCTGCTGGCCTTTCCTGG + Intergenic
1122129984 14:99599329-99599351 CCTGATAACCTGCTCCTCCACGG - Intronic
1123115359 14:105891977-105891999 CCCCATATCCTGCTCTTTCATGG + Intergenic
1124231588 15:27951162-27951184 CCTGAGATGTGGCTCTCTCAGGG - Intronic
1125937833 15:43651584-43651606 CCTGATGGGCTTCCCTTTCAGGG - Intronic
1127811859 15:62572088-62572110 CCTGTTATGCTCTTCTTTCCAGG + Intronic
1129616754 15:77104937-77104959 GCTGAGATGCTCCTCTTCCAGGG - Exonic
1138441414 16:57037263-57037285 CCTGATGTGCAGCTCTGCCAGGG - Exonic
1146377538 17:32304679-32304701 CCTGACATGGTGCTATGTCAGGG - Intronic
1147936071 17:44012043-44012065 CCTGTCATGCTGCTCATTGATGG - Exonic
1148229443 17:45922274-45922296 CCTTATATTTTGCTCTTTGAGGG + Intronic
1148584224 17:48765921-48765943 CATGATAAACTGCTCTTTCAGGG + Intronic
1150564303 17:66325069-66325091 TCTGAGATGCTGCACTTCCAGGG - Intronic
1152354478 17:79800093-79800115 CCTGCAACGCTGCTCTCTCACGG - Intronic
1152497585 17:80684754-80684776 TCTTATATCCTGCTCTTACATGG + Intronic
1153641052 18:7157550-7157572 ACTAACATGGTGCTCTTTCAGGG + Intergenic
1158790300 18:60772560-60772582 CCTGATTTGTTGCATTTTCATGG - Intergenic
1161133822 19:2608002-2608024 CCTGAGACGCAGCTCTTTGAGGG + Intronic
1163500743 19:17674713-17674735 CTTGACATTCTGCACTTTCAGGG + Exonic
1167668615 19:50837039-50837061 CCAGACAAGCTGCTGTTTCAGGG + Intronic
1167956549 19:53069944-53069966 CCTGAACTGCAGCTATTTCAAGG - Exonic
926822884 2:16872540-16872562 CCTCATTTGCTCCTCTTTTAAGG - Intergenic
929378659 2:41322275-41322297 CAAGATAGGCTGCTTTTTCACGG - Intergenic
930668382 2:54122373-54122395 CACGATATGCTGCTCAGTCAAGG - Intronic
931610153 2:64090368-64090390 CCAGACATGCTTCTATTTCAGGG + Intergenic
931662819 2:64584016-64584038 CTTGATCTGCTGATCTTACAGGG + Intronic
932856107 2:75235503-75235525 ATTGATAAGATGCTCTTTCAGGG - Intergenic
933282157 2:80344193-80344215 CCTGATTTTCTCCTCCTTCATGG + Intronic
937256135 2:120557232-120557254 CCTGAGATGTTGCTAGTTCATGG + Intergenic
939404268 2:141735786-141735808 GCTGACATGCTGCTCTTGCTAGG - Intronic
939764220 2:146225911-146225933 TCTGACATGCTGTTCTGTCAAGG - Intergenic
940120021 2:150253938-150253960 CCTTATATGCAGCTCTTCCAGGG - Intergenic
941005155 2:160240158-160240180 CCTGTTTTGCTTCCCTTTCAAGG - Intronic
944427477 2:199598529-199598551 CCTGATCTGCTACTCTTCCTGGG + Intergenic
945700403 2:213162257-213162279 CATGTTATACTGCTCTTTGAAGG - Intergenic
946423005 2:219575402-219575424 CCTGCTGTGCTGCTCTCCCAGGG + Exonic
948151434 2:235747729-235747751 CGTGCTCGGCTGCTCTTTCAGGG + Intronic
948915501 2:241033174-241033196 CCTGATCTGATTCTTTTTCAGGG + Intronic
1169404772 20:5314420-5314442 CCAGACCTTCTGCTCTTTCAGGG + Intergenic
1170530661 20:17287938-17287960 CCAGTCAGGCTGCTCTTTCAGGG - Intronic
1172592643 20:36128363-36128385 CCTTAGATGCTGCTCATTCCTGG + Intronic
1174928948 20:54792731-54792753 CCTTATCTGCATCTCTTTCAGGG + Intergenic
1174952144 20:55054007-55054029 CCTGATATCATGCGCATTCATGG + Intergenic
1177319938 21:19508449-19508471 GCTGAGATGCTCCTCTTTCCAGG - Intergenic
1179776593 21:43667875-43667897 CCTGATATCCTGGTTTTACATGG + Intronic
1180937968 22:19638336-19638358 CCTGAGATTCTGCTAATTCATGG - Intergenic
1182357749 22:29729937-29729959 CCAGATAGGCTGCTGTCTCAAGG - Exonic
1182486082 22:30639770-30639792 GCTGTTATCCTGTTCTTTCAAGG + Intronic
1185022104 22:48382621-48382643 GCTGATAAGCTGCACATTCAGGG + Intergenic
952106005 3:30070033-30070055 CCTGGCATGCTGCCCTTTCCTGG - Intergenic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
952900281 3:38107892-38107914 CCAGATATGCTGCTCCTTTGAGG - Intronic
954332296 3:49897519-49897541 GCTGAGAGGCTTCTCTTTCATGG - Exonic
955309737 3:57873715-57873737 TCTGTAATCCTGCTCTTTCATGG + Intronic
955313725 3:57916989-57917011 CCGAAGATGCTGTTCTTTCAAGG - Exonic
956448749 3:69352143-69352165 CTTGTTATGCAGCTCTTTCAGGG - Intronic
956761555 3:72448363-72448385 CCTGATATGCTTCCCTTCCATGG - Intergenic
958110465 3:89136262-89136284 CCTATTATGCTGACCTTTCAAGG + Intronic
959220224 3:103508765-103508787 ACTAATTTGCTGTTCTTTCAAGG + Intergenic
960739901 3:120821606-120821628 CCTGAAATACTTGTCTTTCAAGG + Intergenic
961679590 3:128590654-128590676 CTTGATATCCCCCTCTTTCAAGG + Intergenic
963436896 3:145282170-145282192 CCTTTTATACTTCTCTTTCAGGG + Intergenic
964088981 3:152850802-152850824 TTTGATATGCTGCTCCTTCCCGG - Intergenic
966222212 3:177562039-177562061 CCTGCCCTGCAGCTCTTTCAGGG - Intergenic
972363497 4:38351021-38351043 CTTGATATTCTGGTCTTTCTTGG - Intergenic
972615076 4:40690444-40690466 CCTGATCTGCTGGCCTTTCACGG - Intergenic
975643254 4:76521912-76521934 CCTGATATGATGCACTGGCAAGG + Intronic
977980774 4:103318896-103318918 CCTGATATGCACTTCTTTTAAGG + Intergenic
980877588 4:138677402-138677424 TCTTATATGCTGCTCTTTCTAGG - Intergenic
984847685 4:184121616-184121638 CTAGACATGCTCCTCTTTCAAGG + Intronic
984880301 4:184404888-184404910 CCTGAGATGCTGTTTTCTCACGG - Intronic
985698571 5:1357230-1357252 CCTGATCTCCTGTTCTTACAAGG + Intergenic
985826812 5:2198148-2198170 CCTGTTATGCTCCCCATTCAGGG - Intergenic
988915149 5:35884611-35884633 CCAGATGTGCTGCTCTCTCAGGG - Intergenic
989255769 5:39364457-39364479 GCTGACATGCTGCTCTTGCTGGG + Exonic
989707335 5:44352093-44352115 CCAAATGTGCTCCTCTTTCATGG - Intronic
991614149 5:68478614-68478636 CCTGAAATGTTTCTATTTCAGGG + Intergenic
999041951 5:148423862-148423884 CAGTATATGCTGTTCTTTCAGGG + Intronic
999907074 5:156153479-156153501 CCTGAAATCCTGCTCTTTAAGGG + Intronic
1000566613 5:162855766-162855788 GCTGATATCCAGCTCTTCCAGGG - Intergenic
1000679315 5:164162907-164162929 GCTGATTTGCTCATCTTTCATGG + Intergenic
1001999222 5:176187996-176188018 CCTGAAATGCTGCTCTACAAAGG + Intergenic
1004016141 6:11733617-11733639 TCTGTTATGCTCCTCTTTCCCGG + Intronic
1005692937 6:28324419-28324441 CCTCAGATGCTGCTGGTTCATGG - Intergenic
1006543474 6:34759442-34759464 CAAAATATGATGCTCTTTCAAGG - Intronic
1008591009 6:52994131-52994153 CCTTATATGCTGTTTCTTCACGG - Intronic
1010121213 6:72378031-72378053 CCTGCTCTGCTGTTGTTTCAAGG + Intronic
1010513838 6:76750026-76750048 TCTGATGTGCTTCTCTTTGAGGG + Intergenic
1013399753 6:109781349-109781371 CCTCATATGCTGTGGTTTCAAGG + Intronic
1014211176 6:118709781-118709803 CCTGATAAGCAGCCCTGTCAGGG - Intronic
1014458725 6:121669309-121669331 CCAGCTATGCTGTTCTCTCAGGG - Intergenic
1017316331 6:153035786-153035808 CCCCATATGCTCCTCCTTCAGGG - Intronic
1017563785 6:155662626-155662648 ACTGATTTGCTGCTCTCTTATGG - Intergenic
1021166382 7:17347637-17347659 TATGCTATGCTGCTCTCTCAGGG - Intergenic
1022713813 7:32878278-32878300 CCTGTTCTGCTGTTCTTTAATGG - Intronic
1023770279 7:43550664-43550686 CCTGAGCTGCTGCTCCCTCAGGG - Intronic
1026575899 7:71571294-71571316 CATGATAGGCTGCTCGTTCGTGG + Exonic
1026582783 7:71632144-71632166 CCTGAAAAGATGCTCTTACAAGG + Intronic
1028309336 7:89310839-89310861 CCTGCTGTGCAGCTCCTTCATGG - Intronic
1029696275 7:102215411-102215433 GCTGGGATGCCGCTCTTTCACGG + Intronic
1031540522 7:122989546-122989568 CCTGTTTTACTTCTCTTTCAAGG + Intergenic
1035392486 7:158514477-158514499 GCTGAGATCCTTCTCTTTCATGG - Intronic
1035849472 8:2900950-2900972 TCTGATCTGCTGCTCATCCAAGG - Intergenic
1037332407 8:17756443-17756465 GCTGATTTGCTGGGCTTTCATGG - Intronic
1042609614 8:70583693-70583715 TCTGATTTTCTGCTCTTGCAAGG + Exonic
1046050599 8:109017526-109017548 CCTGGTATGCTGCTGTTTCATGG + Intergenic
1046182626 8:110672173-110672195 CCTGTTATGCTTCTGTCTCATGG + Intergenic
1047182176 8:122599475-122599497 CTTGAACTGCTGTTCTTTCATGG + Intergenic
1047588445 8:126300322-126300344 CCTGAGATTCTGCTTTTTGAAGG + Intergenic
1049795624 8:144496146-144496168 CCTGCTAGGCTGCTCCTCCAGGG - Intronic
1049880428 8:145058327-145058349 CCTGCTAAGCAGGTCTTTCATGG - Intergenic
1050245006 9:3680218-3680240 CCTGATGTGCAGCTCTTTGGAGG + Intergenic
1052237891 9:26234872-26234894 CCAGATATGCTCCTCACTCAAGG + Intergenic
1052581658 9:30363890-30363912 CCTAATCTGCTTCTCTTTCTAGG - Intergenic
1056032552 9:82568010-82568032 CCTGATATGGATCTCTTTCCAGG + Intergenic
1056074462 9:83024282-83024304 CCAGCTAGGCTGCTTTTTCATGG - Intronic
1057007857 9:91576409-91576431 CCTGATTTCCTCCTCTTACAAGG - Intronic
1057221476 9:93259981-93260003 CCTGACAAGATGCTCTTTGAAGG - Intronic
1058346127 9:103965184-103965206 ACAGATTTCCTGCTCTTTCACGG - Intergenic
1062688336 9:137827878-137827900 CCTCCTGTGCTGCTCTTCCAAGG - Intronic
1187936712 X:24343398-24343420 CCTGATGGGCTGCTCTCTGAAGG - Intergenic
1188514847 X:30974175-30974197 GCTGAGAACCTGCTCTTTCATGG - Intronic
1189247183 X:39572307-39572329 CCTTATATGCTCCTCACTCATGG - Intergenic
1189266574 X:39721255-39721277 CCTAATATGATACTCTTTCCTGG - Intergenic
1190969511 X:55335035-55335057 GCTGATATGCAGCTCTGACATGG + Intergenic
1193350181 X:80454653-80454675 CCTGATGTGATTCTCTTCCATGG + Intergenic
1193527176 X:82606589-82606611 CCTGAAATGTTGGCCTTTCAAGG - Intergenic
1194607997 X:96005673-96005695 CCTGAGAAGCTGCTCTGCCAAGG - Intergenic
1194723731 X:97370478-97370500 CCTCATATACTGCTAATTCATGG - Intronic
1196018208 X:110961904-110961926 CCTGAAAATCTGTTCTTTCATGG + Intronic
1197302784 X:124801963-124801985 TCTGATAGGCTTCTCTTTGAAGG + Intronic
1197948614 X:131869899-131869921 CTGGATTTGCTTCTCTTTCATGG - Intergenic
1201279399 Y:12328022-12328044 CCTGACATGCAGTTCTGTCAGGG - Intergenic
1201582968 Y:15530642-15530664 TCTGATAGGCTTCTCTTTAAGGG + Intergenic