ID: 922537740

View in Genome Browser
Species Human (GRCh38)
Location 1:226394445-226394467
Sequence GCCAAATTGCCTTCCAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 3, 2: 7, 3: 55, 4: 253}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922537740 Original CRISPR GCCAAATTGCCTTCCAGAAA AGG (reversed) Intronic
900894180 1:5471727-5471749 GCCAAATTATCTTCCCCAAAAGG + Intergenic
902270782 1:15302991-15303013 GCCTAGTTACCTTCCAGAATAGG + Intronic
906300692 1:44679501-44679523 GCCAAATGGCATTCAAGAAGGGG - Intronic
909113640 1:71508426-71508448 GCCATATTAACTTTCAGAAATGG - Intronic
909484720 1:76159992-76160014 ACTAAACTGCCTTCCAGAGAAGG + Intronic
909822546 1:80084642-80084664 GCAGAATTGGCTTCCAGACAGGG - Intergenic
909930721 1:81496295-81496317 GCCAACTTGCCATGCATAAAAGG - Intronic
911301093 1:96175188-96175210 GCCAAATTTCCCTAGAGAAATGG - Intergenic
915255677 1:154627135-154627157 GGAAACTTGCCTTCCAAAAAGGG - Intronic
916421983 1:164646122-164646144 ACCAAAATGCCATCAAGAAAAGG - Intronic
916819468 1:168384565-168384587 ACCAAATTGGCTTTCAGAAAAGG + Intergenic
917397438 1:174609255-174609277 GTCAAAATACCTTCCACAAATGG + Intronic
917946981 1:179984024-179984046 GTCAAATTGTCTTCCAAGAAGGG - Intronic
918130442 1:181622812-181622834 CTCAAATAGACTTCCAGAAAAGG - Intronic
919664594 1:200279868-200279890 TCCAACTTTCCTTCCAAAAACGG + Intergenic
922537740 1:226394445-226394467 GCCAAATTGCCTTCCAGAAAAGG - Intronic
922689560 1:227677501-227677523 GCCATATTAACTTCCAGAAATGG - Intergenic
922917760 1:229271933-229271955 GCCAAAATGCAACCCAGAAAAGG - Intronic
923498186 1:234542861-234542883 GACAAATGTCCTTCCAGAAGAGG + Intergenic
923607623 1:235458967-235458989 GCCAAATTGCTTTCCAGAGTGGG - Intronic
923885816 1:238154205-238154227 CGTAAGTTGCCTTCCAGAAAAGG + Intergenic
924550491 1:245071643-245071665 GCTAAAATGCCGTCCAGGAAGGG - Intronic
924710315 1:246525809-246525831 GCCAAACTGTCTTCCACAATGGG - Intergenic
1063016862 10:2087127-2087149 GCCACAGAGCCTTCCAGAATAGG + Intergenic
1063475644 10:6326529-6326551 CCCAAATTGTCTTCTAGATATGG + Intergenic
1064030671 10:11880697-11880719 GCCACACTGCCTCCCAGATATGG + Intergenic
1064273345 10:13884825-13884847 GTCACCTAGCCTTCCAGAAAGGG - Intronic
1064509246 10:16071669-16071691 GCCACACTGCATTCCAGGAAGGG - Intergenic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1066155827 10:32676790-32676812 GCCACACTGCCTTCCACAATGGG - Intronic
1066169118 10:32822038-32822060 GCAAAACTGCTTTTCAGAAAAGG + Intronic
1067671887 10:48331388-48331410 GCCATATTAACTTCGAGAAATGG + Intronic
1069722453 10:70558333-70558355 ACCCCTTTGCCTTCCAGAAAGGG - Intronic
1070157307 10:73843364-73843386 GACAAATTTCCATCCAAAAAAGG - Intronic
1070520852 10:77252022-77252044 GCCTAATTGACTTCCTGAACTGG - Intronic
1073087657 10:100904262-100904284 GCACAATTGCTTTCCATAAATGG - Intergenic
1073344717 10:102774262-102774284 GCCAAACTGCCATACAGACAAGG - Intronic
1074890152 10:117729197-117729219 GCCATTTTGCCTTCCAGGATAGG - Intergenic
1075379553 10:122007913-122007935 GCCAAATTGGCTTTCATAACAGG - Intronic
1075953574 10:126503631-126503653 CCCAAATTGCGTTCCAAAAGAGG - Intronic
1076301119 10:129427088-129427110 GCCAATCTGTCTTTCAGAAAGGG - Intergenic
1080256980 11:30301473-30301495 GCCAAACTGCTTTCCATAATGGG - Intergenic
1080314640 11:30935506-30935528 GCCATATTAACTTCCAGAAATGG + Intronic
1081590434 11:44419176-44419198 ACCCACTTGCCTGCCAGAAAAGG + Intergenic
1081723727 11:45310096-45310118 GCCACACTGTCTTCCACAAATGG + Intergenic
1081840328 11:46196053-46196075 TCCAAATTGCCCTCCAGAAAGGG + Intergenic
1084607062 11:70178525-70178547 CTCAAATTGCCTACCAGCAATGG + Intronic
1085453108 11:76649101-76649123 GCCAAAGGGCCCTCCAGAATAGG + Intergenic
1085567863 11:77530996-77531018 AACAAATTGCCTTGCACAAAAGG - Intronic
1085783558 11:79431522-79431544 GCCAAATTGCTTACCTAAAAGGG + Intronic
1085940352 11:81200140-81200162 GCCATATTAACTTTCAGAAATGG - Intergenic
1086419099 11:86620305-86620327 GGCAATTTGCCTTCATGAAATGG + Intronic
1086482878 11:87262318-87262340 GCCAGATTGTCCTCCAAAAAAGG + Intronic
1087852665 11:103050408-103050430 CCCTAAATGACTTCCAGAAAAGG + Intergenic
1088128864 11:106462702-106462724 GCCAAATTTCCCTTCAGAAGGGG - Intergenic
1088354671 11:108930219-108930241 CCCATATGGCATTCCAGAAAAGG - Intronic
1088614307 11:111608870-111608892 GCCAAATTACCCTCCAGAAAAGG + Intronic
1090556434 11:127881598-127881620 GCCAAGTTGCCTTCCAAAACAGG + Intergenic
1090632520 11:128662653-128662675 CACAAACTGCCTTCCACAAATGG + Intergenic
1090852399 11:130582023-130582045 TCCCAATTGCATTCCAGAGATGG + Intergenic
1091144852 11:133269686-133269708 GCTGAATTTCATTCCAGAAATGG + Intronic
1097748168 12:63322779-63322801 TCTAAATTGCTCTCCAGAAAAGG - Intergenic
1100430307 12:94526312-94526334 GCTAAATTATTTTCCAGAAATGG + Intergenic
1100692684 12:97055828-97055850 GCCAAATTGCCTTCTAGGAAGGG + Intergenic
1100852258 12:98725398-98725420 TCCTAATTGCCTTCCAGATCTGG + Exonic
1101645739 12:106629423-106629445 GCCAAATGACCTTCCATACAGGG + Intronic
1102829304 12:115981569-115981591 GCCAAATTCCATTCCAAAAGAGG - Intronic
1103301288 12:119929322-119929344 GCCAAATTGCCCTCCCAAAGCGG + Intergenic
1104060999 12:125268237-125268259 GCCAAACTCCCCTCCAGAGAAGG - Intronic
1104708139 12:130963864-130963886 GCCAAATTACCCTTCAGAAGGGG + Intronic
1104745107 12:131205593-131205615 GCCAAATTGGTTTCATGAAAAGG - Intergenic
1104789290 12:131471806-131471828 GCCAAATTGGTTTCATGAAAAGG + Intergenic
1105391027 13:19978217-19978239 GCCATATACCCTTCCAAAAATGG + Intronic
1106186686 13:27415884-27415906 GCCAAGAAGCCATCCAGAAATGG + Intergenic
1107186344 13:37525970-37525992 CCAAAATAGCCTTCCAGAGAAGG + Intergenic
1108343136 13:49517258-49517280 GTGAAATTGCCTTGCAGAACAGG - Intronic
1108935165 13:55873616-55873638 GCCATATTAACTTCCAGAAATGG + Intergenic
1110930890 13:81215264-81215286 GGACAATTGCCTTCCAGCAAAGG + Intergenic
1111552374 13:89831156-89831178 GCCAAATTCTCTTTCATAAATGG + Intergenic
1111586715 13:90291558-90291580 GCCATATTAACTTCCATAAATGG - Intergenic
1112072850 13:95874038-95874060 GCCAAATTGAGTTCCAGTACTGG - Intronic
1112165179 13:96910444-96910466 GAAAAATTGTCTTCCACAAAAGG + Intergenic
1112406920 13:99129108-99129130 GCCAAACTGCCTTCCAAAATAGG - Intergenic
1113404801 13:110028715-110028737 GCCATATTTCTTTCCAAAAAGGG - Intergenic
1114572173 14:23679219-23679241 GCCAAATTGTCCTCCATAGATGG - Intergenic
1115323042 14:32106091-32106113 GCCAAACTGTTTTCCAGAATGGG + Intronic
1117042812 14:51782455-51782477 GCTAAACTGTCTTCCCGAAATGG + Intergenic
1117107240 14:52410313-52410335 TGGAAATGGCCTTCCAGAAATGG - Intergenic
1118118847 14:62813122-62813144 GCCAAACTGCATCCTAGAAAAGG + Intronic
1119347544 14:73938818-73938840 ACCAACTTACTTTCCAGAAAAGG - Intronic
1120663628 14:87279735-87279757 CCCACATGGACTTCCAGAAATGG + Intergenic
1121968528 14:98334369-98334391 GCCAAATTGCTCTCCAAAATGGG - Intergenic
1122729152 14:103782546-103782568 GCCAAATTTCCTTCTATAGAAGG + Intronic
1128015375 15:64340606-64340628 GCCTAATTACCTTGCAGCAAAGG + Intronic
1128026175 15:64438865-64438887 ACCAGATTGTCTTCCACAAATGG + Intronic
1128043765 15:64598869-64598891 GCCAAACTGCCCTCTAGAGAAGG + Intronic
1128593325 15:68922168-68922190 GCCAAACTGCCTTGCAGAGGTGG + Intronic
1128917450 15:71577177-71577199 ACAAAATTTCCTTCCACAAAAGG - Intronic
1130230050 15:82090005-82090027 GCTAAATTTCCCTCCAGAAAAGG + Intergenic
1133816993 16:9205056-9205078 CCCAACTGGCCTTGCAGAAATGG + Intergenic
1134297685 16:12961418-12961440 CTCAAGTGGCCTTCCAGAAATGG - Intronic
1137830753 16:51540762-51540784 GCCAGATGGGCTTCTAGAAATGG + Intergenic
1138046508 16:53731037-53731059 GCCAAGTTGCCTTATGGAAAAGG + Intronic
1138913880 16:61438897-61438919 GCCAAATTGCCTTCTAAATGTGG - Intergenic
1140215475 16:73003880-73003902 GCCAAATGATCCTCCAGAAAGGG + Intronic
1140715975 16:77726048-77726070 GCCAAATTGCCCCCCACCAAGGG + Intronic
1141033344 16:80608324-80608346 GGCAAGATGCCTTCCAGAACTGG - Intronic
1141199523 16:81886412-81886434 GCCAAAGTGTTTTCTAGAAAAGG - Intronic
1141824270 16:86468107-86468129 TCCACATTGTCTTGCAGAAATGG - Intergenic
1142148849 16:88503914-88503936 GGAAAAGTCCCTTCCAGAAAAGG - Intronic
1144657512 17:17046477-17046499 ACGAAATTGCCTTCCAAAAAAGG + Intronic
1145086126 17:19942484-19942506 GCCAAATTGCCTTCAGAAAAAGG - Intronic
1146450671 17:32971597-32971619 GCCATATTAACTTCCAGAAATGG - Intronic
1148525572 17:48329745-48329767 GCCACACTGCCTCACAGAAAAGG - Intronic
1149983214 17:61327922-61327944 ACCAAACTGCCTTCCAAAAAGGG - Intronic
1151407716 17:73900262-73900284 TGAAAATTACCTTCCAGAAAGGG - Intergenic
1158126885 18:54109918-54109940 GCCAAGCTGCTTTCCAGAACGGG - Intergenic
1158665776 18:59431418-59431440 GTCAAATAACCTTCCTGAAAAGG - Exonic
1159825497 18:73204102-73204124 GGCAAATTTCAGTCCAGAAATGG - Intronic
1160287970 18:77564063-77564085 ACCAAACTTCCTTGCAGAAATGG - Intergenic
1163621400 19:18362920-18362942 GACAAATTGCCTTCCACACGGGG + Intronic
1164983697 19:32632702-32632724 GACAAATTCGCTTCCTGAAAAGG + Intronic
1166914351 19:46184827-46184849 GCCACATTGTCTTCCACAATGGG + Intergenic
1167830713 19:52019689-52019711 CCCAAATGGCCTTCCAAAATTGG - Intronic
925640874 2:5985096-5985118 GCCACATTGCCTCCAAGAACAGG - Intergenic
926039995 2:9665358-9665380 GGCAAAATGTCTTCCAGAAAAGG + Intergenic
926892069 2:17647456-17647478 GCCAAAGTACCCTCTAGAAAGGG + Intronic
927700712 2:25266840-25266862 GCCAAACTGCCCTCTAAAAAGGG - Intronic
928431747 2:31225425-31225447 ACCAAATTGCTTTCCAAAAAAGG - Intronic
929428220 2:41865329-41865351 TCAAACTTGCCTTCAAGAAAAGG + Intergenic
930293078 2:49520022-49520044 GCCACATTGTCTTCCACAATTGG - Intergenic
930308560 2:49708606-49708628 GCCACATTGCCCTCCAAAAGAGG + Intergenic
931264372 2:60647362-60647384 GCCATAGTTCCTTCCAAAAAGGG - Intergenic
931758068 2:65391742-65391764 ACCAAACTGCTTTCCAGAAAGGG + Intronic
935567289 2:104622278-104622300 GCTAATTTGCCTTTCAGAAAGGG + Intergenic
935955568 2:108373494-108373516 GCCAAATTACTTTCCAGAGTGGG - Intergenic
936459252 2:112700089-112700111 GTCAGATTGCCTTCCAGAAGTGG + Intergenic
938224554 2:129604739-129604761 GCCACAGTGCCCTCCAGAGAGGG + Intergenic
938450987 2:131419774-131419796 GACAAATTGCTTTCCAGCAGTGG - Intergenic
939636987 2:144594167-144594189 ACCAAATTGCTTTCCCTAAATGG - Intergenic
939869492 2:147510964-147510986 GCCATATTCCCTTACAGAGAAGG + Intergenic
943044281 2:182840218-182840240 GCCAAATGGCATTTCAAAAAGGG - Intronic
943786062 2:191880419-191880441 CCAAGATTGCCTTACAGAAATGG + Intergenic
943953285 2:194157209-194157231 GCCATATTAACTTCCAGAAATGG + Intergenic
944306775 2:198188273-198188295 CCAAAAGTGGCTTCCAGAAAAGG + Intronic
944499470 2:200343513-200343535 GACAAACTGCCCTCTAGAAAGGG - Intronic
945548659 2:211190741-211190763 GAGAAACTGCCTCCCAGAAAGGG + Intergenic
946343267 2:219086529-219086551 GACAAAATGCCCTCTAGAAAAGG + Intronic
946808340 2:223495712-223495734 GCTAAATTGCTTTTCAGAAATGG - Intergenic
946975078 2:225139386-225139408 TCCAATTTTCCTTTCAGAAATGG + Intergenic
947169192 2:227294057-227294079 GCCAAAATTCAATCCAGAAATGG - Intronic
947397882 2:229704270-229704292 GCCAAAGTGTTTTCCAGAAGAGG - Intronic
948555154 2:238804454-238804476 TCAAAAATGCCTTCCATAAATGG - Intergenic
948606003 2:239135574-239135596 GCCAAATTGTCCTGCAGAAAGGG - Intronic
1169055248 20:2615460-2615482 CCCAATTTGTCTTCCAGAAATGG - Intronic
1170035646 20:11986673-11986695 CCCAAATTGTCCTCCAGAAATGG - Intergenic
1170487441 20:16833191-16833213 GCCAAATTGTTATCCAAAAATGG + Intergenic
1171530606 20:25850628-25850650 ACTAAATTGCCTTGTAGAAAAGG - Intronic
1171965262 20:31525071-31525093 GCCAAATTACCCTCCCGAAAAGG + Intronic
1173086900 20:39929508-39929530 TTCAAATTGCTTTCCAAAAAAGG + Intergenic
1173449437 20:43149849-43149871 GCCATTTTACCTTCCAAAAAGGG - Intronic
1174701987 20:52618198-52618220 TCCAAATATCCTTCCAAAAAAGG - Intergenic
1175107267 20:56624579-56624601 GCTAATTTGCCTTAAAGAAAGGG - Intergenic
1175145468 20:56892877-56892899 CACAAATGGCCTTCCATAAAAGG - Intergenic
1176696429 21:9983106-9983128 CACAAATTACCTTTCAGAAAAGG + Intergenic
1178331910 21:31704457-31704479 GCTAAATTGTCTTCTATAAAGGG - Intronic
1179001700 21:37467211-37467233 ACCAAATCGCATTCCAGAAATGG + Intronic
1179026769 21:37685308-37685330 GCCAAATTGCCCTCCTACAAAGG - Intronic
1179903166 21:44405631-44405653 GCCCTATTGCCTCCGAGAAAGGG - Intronic
1183948208 22:41338658-41338680 TCCTCATTGGCTTCCAGAAAAGG + Intronic
949554743 3:5143265-5143287 GCCATATTAACTTCCAGAAATGG + Intronic
949902497 3:8828895-8828917 GCCAAATGGTTTTCCAGAATGGG - Intronic
950035251 3:9880357-9880379 GCCAGCCTGACTTCCAGAAAAGG + Intergenic
951378131 3:21948939-21948961 GACAAATTGCCCTCCAGGAATGG + Intronic
951788088 3:26445960-26445982 GCTAAGTTGCTTTCCAAAAAGGG + Intergenic
953574244 3:44100272-44100294 GAAAAATTATCTTCCAGAAATGG + Intergenic
953789285 3:45934928-45934950 GCCAAGTTGCTCTCCAGAAAGGG + Intronic
953811089 3:46113486-46113508 GCCATATTAACTTTCAGAAATGG + Intergenic
954721453 3:52567434-52567456 ATCAAACTGCCTTCCATAAAGGG + Intronic
955462078 3:59194212-59194234 GCCAAATTGCCTTTCAGAAATGG + Intergenic
955756935 3:62234400-62234422 GCCAAGTTGCCCTCCATAATGGG + Intronic
955770779 3:62383030-62383052 GACAAACTGCCCTTCAGAAAGGG + Intergenic
955902725 3:63774466-63774488 GCCCAAATGCCTTCCAGCAAGGG + Intergenic
955949538 3:64228332-64228354 GCCTAATTGCATTCAAGAGAGGG + Intronic
958762752 3:98328543-98328565 GCCAAATAGCCTTCAGGAAAGGG - Intergenic
959022446 3:101203109-101203131 GCTAAATTTCCTTCTAGAAGTGG - Intergenic
959045910 3:101473305-101473327 GCCACATTGTCTTCCACAATGGG + Intronic
959693816 3:109227901-109227923 TCCAAATTGTCTTCCAAAAAAGG - Intergenic
960797045 3:121498476-121498498 GACAAATGGCCATCCATAAAAGG - Exonic
960865562 3:122195889-122195911 GCTAAATTGCCCTCCAGAAAGGG - Intronic
963246304 3:143066850-143066872 GCCAACTTGCCTTCCAAAAATGG + Intergenic
963389068 3:144634319-144634341 GCCAAAATGTCTTCCAGAGTGGG - Intergenic
963518502 3:146336880-146336902 GCCATATTAACTTCTAGAAATGG - Intergenic
963518654 3:146338099-146338121 GCCATATTAACTTCCAGAAATGG + Intergenic
963994828 3:151695737-151695759 GCCAACTTGCTTGGCAGAAATGG - Intergenic
966392921 3:179471864-179471886 GACAATTTGTCTTGCAGAAAGGG - Intergenic
967520190 3:190421244-190421266 GCCAAATTGGCCTTCAAAAAAGG + Intergenic
967630700 3:191740643-191740665 GACATATTAACTTCCAGAAATGG + Intergenic
968784171 4:2606923-2606945 GCCAAATTGCCTTGAAGTGACGG + Intronic
971230549 4:24797730-24797752 ACTAAATTGCCTTTCTGAAATGG + Intronic
973624936 4:52762145-52762167 GCCAAATTACTTTCCAGAATGGG + Intergenic
973728351 4:53798693-53798715 TCCAAATTGCTCTCTAGAAAAGG + Intronic
974179237 4:58362573-58362595 GCCAAATTGTGTTCCACAGAGGG - Intergenic
974311250 4:60212233-60212255 GTCAAACTGCATCCCAGAAAAGG + Intergenic
975173296 4:71258244-71258266 GCAAACTTGTCTTCCTGAAATGG + Intronic
976643113 4:87360297-87360319 GCCAAACTGCCTTCCAGAAAAGG - Intronic
977143475 4:93406162-93406184 GCCTAATTTCCTGCCACAAAAGG + Intronic
977513982 4:97997008-97997030 GCCAAACTGCTTTCCAGCAATGG - Intronic
978408212 4:108401296-108401318 GCAAAGTTTCCTTCCATAAAAGG + Intergenic
979276273 4:118817662-118817684 CCCAAATTGATTTCCAGAACTGG - Intronic
980369042 4:131843273-131843295 CACAAATTACCTTTCAGAAAAGG + Intergenic
981144398 4:141308395-141308417 GTCAAATTGCCCTCCAAAAAGGG + Intergenic
981300103 4:143177758-143177780 GCCATATTAATTTCCAGAAATGG + Intergenic
981765354 4:148242345-148242367 GCCAGATTGCTTTCCAAAGATGG - Intronic
983982059 4:174009937-174009959 GCCAAATTGCATTCTCAAAATGG - Intergenic
984261646 4:177450151-177450173 ACTAAATGACCTTCCAGAAAAGG - Intergenic
985889322 5:2703419-2703441 GCCCAATTCTCCTCCAGAAATGG + Intergenic
986878850 5:12144998-12145020 GGCAAATTGTCTTTTAGAAAAGG + Intergenic
987237369 5:15956600-15956622 GTCAAATAGCCTTCCAAAAAAGG + Intergenic
993069456 5:83141376-83141398 GCCAAATTTCTCTCCAGAAAAGG + Intronic
995157525 5:108932592-108932614 GCCACATTGTCTTCCACAATAGG + Intronic
996414791 5:123198640-123198662 CCCAAATTATCTTCCTGAAAAGG + Intergenic
996894831 5:128468536-128468558 GCCAAATTATTTTCCAGAATAGG + Intronic
997721597 5:136082364-136082386 GCCAAGTTGTCATCCAAAAATGG + Intergenic
998621874 5:143803153-143803175 GCTACGTTGCCTTCCAGGAAAGG - Intergenic
1001087328 5:168709942-168709964 GCCAAATTGATTTTCAAAAAGGG - Intronic
1001538583 5:172520012-172520034 GCCACATTGTCTTCCAAAAATGG - Intergenic
1001742183 5:174062614-174062636 GCAGAATTTCCATCCAGAAATGG + Intronic
1001839212 5:174859420-174859442 GCCACATTGTCTTCCACAATGGG + Intergenic
1002599061 5:180343863-180343885 GCCAGATTGCTTTCCAAAGAGGG - Intronic
1002885267 6:1288167-1288189 GCCAAATTGCCCTGCAGAAATGG + Intergenic
1004240365 6:13915965-13915987 GCCAAAGAGCCTGCAAGAAAGGG + Intergenic
1004543973 6:16579055-16579077 GCCAAATTTCACTCCAGAGATGG + Intronic
1006415163 6:33899356-33899378 GCCACATTGCCCTCCAGCCAAGG - Intergenic
1007176922 6:39903352-39903374 ACCAAATTGGGTACCAGAAATGG - Exonic
1007325619 6:41057347-41057369 GCCAACCTGCCTTCCACAGAGGG + Intronic
1007453371 6:41957328-41957350 TCAAAATTGCCTTCAAGAAGAGG + Intronic
1007524223 6:42477482-42477504 TCCAAATTCTCTTTCAGAAATGG - Intergenic
1009609042 6:65914208-65914230 TCAAAATTGCCATTCAGAAAAGG + Intergenic
1009835011 6:68988900-68988922 AATAAATTGCCTTTCAGAAATGG + Intronic
1010742746 6:79527313-79527335 GCCATATTAACTTCCAGAAATGG - Intronic
1011248548 6:85345727-85345749 GCCAAATTGCTTTTCTGAAGTGG - Intergenic
1012010724 6:93781366-93781388 GCCCAATTGCCATCTTGAAATGG - Intergenic
1012577113 6:100816329-100816351 GCCACACTGCTTTCCACAAATGG - Intronic
1013372864 6:109484953-109484975 ACAAAATTGCCTTGAAGAAAGGG - Intergenic
1016362509 6:143283362-143283384 GCCAAATCAGCTTCCAGAAATGG - Intronic
1017833508 6:158154338-158154360 GACAAACTGCATTACAGAAAAGG + Intronic
1019175284 6:170156493-170156515 GCCGAATTGACTTCCACAGAAGG + Intergenic
1019790864 7:3013022-3013044 GCCAAATTGCCCTCAAAAACTGG - Intronic
1020446408 7:8273299-8273321 ACCAAGTTGCCTTCCATAACGGG - Intergenic
1020936934 7:14477516-14477538 GCCATATTTCCTTCTAGAAATGG + Intronic
1021422083 7:20456992-20457014 GCCAAATTGCCCTCAAGAAGAGG - Intergenic
1023158516 7:37275375-37275397 GCAAGATTGCTTTCAAGAAAGGG + Intronic
1023326652 7:39067961-39067983 GCCAAATTGCCTTCAAGATCAGG - Intronic
1024083022 7:45871912-45871934 TCCAAACTGCCTTCCATAGAAGG - Intergenic
1027376751 7:77558317-77558339 GCCAAACTGCCTTCCAAAACAGG - Intronic
1028741745 7:94283266-94283288 GATGAATTTCCTTCCAGAAAGGG - Intergenic
1030448479 7:109678029-109678051 GTCAAATTCCCCTCCATAAATGG + Intergenic
1030789355 7:113705017-113705039 GGCAGATTGCCTTCCATAATGGG + Intergenic
1031104214 7:117519933-117519955 AATAAATTGCTTTCCAGAAAAGG + Intronic
1031697909 7:124883079-124883101 GCTTAACTGCCTTTCAGAAATGG - Intronic
1032753616 7:134866891-134866913 CCCAAAATGACTACCAGAAAGGG - Intronic
1033661188 7:143403623-143403645 GTCAAATTGTCTTCCAAAAAAGG + Intronic
1035995045 8:4536817-4536839 GCCAAATTTCCTTTCACAAGGGG + Intronic
1036490100 8:9217103-9217125 GCCATATTGCTTTCCACAATGGG + Intergenic
1036764934 8:11543429-11543451 GCAAAAGTGCCTTCCTGATAGGG + Intronic
1037989513 8:23310705-23310727 GCCAAATTGCCTTCTTAACAGGG + Intronic
1039418256 8:37414178-37414200 GCCAAATTACCATCTAGAAATGG - Intergenic
1039937437 8:42058209-42058231 GCAAAAATGTCTTTCAGAAATGG + Intergenic
1041200147 8:55445919-55445941 GCCAAATCTCCTAACAGAAAAGG + Intronic
1043307195 8:78809784-78809806 CCCAAATCGCCTTTCAGAGAGGG + Intergenic
1044107277 8:88225729-88225751 GCCAAATTGCCTTCTAGAAAAGG + Intronic
1044736887 8:95287958-95287980 GCCACACTGTCTTCCACAAATGG + Intergenic
1045423951 8:102044416-102044438 GCCATATTTCATTCCACAAATGG + Intronic
1045789150 8:105961137-105961159 GCCATATGGCCTTCCAGATTCGG - Intergenic
1046021589 8:108671834-108671856 TCCATATTGCCTTCCATAAAAGG + Intronic
1047440721 8:124875637-124875659 GCCACACTGACTTCCACAAATGG + Intergenic
1048419998 8:134268756-134268778 GCCAAACAGCCTTCCTGAATGGG - Intergenic
1049906532 9:222437-222459 GCCAAATTGACGCCCAGAAAAGG + Intronic
1050675003 9:8042190-8042212 GCCACACTGCCTTCCACAATGGG + Intergenic
1051524232 9:18024838-18024860 TCCAAATTGTTTTCCAGAGAGGG + Intergenic
1051670799 9:19508347-19508369 GCCAAATTGCCCTAAAGAAAGGG - Exonic
1052488657 9:29134874-29134896 GCTATATTATCTTCCAGAAATGG + Intergenic
1053277589 9:36794998-36795020 GCCCAATTTCCTTCCAGATGGGG + Intergenic
1053440347 9:38111067-38111089 ACCAAATTGACCTCCAAAAAGGG - Intergenic
1053633406 9:39968947-39968969 CACAAATTACCTTTCAGAAAAGG + Intergenic
1053772341 9:41494533-41494555 CACAAATTACCTTTCAGAAAAGG - Intergenic
1054210481 9:62281750-62281772 CACAAATTACCTTTCAGAAAAGG - Intergenic
1055613495 9:78047398-78047420 GCCAAATTTCTCTCCAGAAAAGG - Intergenic
1055823550 9:80297391-80297413 GCCACATTGTCTTCCACAATGGG - Intergenic
1056068206 9:82958660-82958682 GCCCAATTTCCTTCCAGATAAGG - Intergenic
1056628286 9:88272308-88272330 GCCAAAGTGCCTTTCAAAAAAGG - Intergenic
1056849528 9:90070619-90070641 GCCAATTTGGTTTCCAGTAAGGG + Intergenic
1056986944 9:91372000-91372022 GGCAAATTGCCTTCCTTAACAGG - Intergenic
1057431291 9:94996736-94996758 GACAAAATGCCTTACAAAAAGGG - Intronic
1058134319 9:101290512-101290534 GTCAAATTGCAATGCAGAAAGGG - Intronic
1058148378 9:101436724-101436746 CCCAAATTTAATTCCAGAAAAGG + Intergenic
1059069697 9:111121994-111122016 GCCAAATTGCCTGTCAGAAATGG + Intergenic
1060144011 9:121235444-121235466 TCCTAATTGTCTTCCAGAATAGG - Intronic
1060385978 9:123228754-123228776 GCCAAATTGTTTTTCAAAAATGG - Intronic
1061176163 9:128998675-128998697 GCCTGCTTGCCTTCCTGAAAGGG + Intronic
1061474998 9:130859251-130859273 GGCAAATTTCTTTCAAGAAAAGG - Intronic
1061630465 9:131868995-131869017 GCCAGATTGCCGACCAGCAATGG - Intronic
1061900977 9:133671820-133671842 GCCAGATTGCCATCAAGAAATGG + Intronic
1062062801 9:134505589-134505611 TCCAAATTGCTTTCCAGAGTGGG + Intergenic
1186167989 X:6847198-6847220 GACAACCTGCCTTCGAGAAAGGG - Intergenic
1186802899 X:13111307-13111329 GCCAAATTGGATACCAAAAATGG + Intergenic
1188287301 X:28343497-28343519 GCCAAATTGTCTTCTAACAAAGG + Intergenic
1188594315 X:31878917-31878939 GCCAAACTGCCTTCCACAAGAGG - Intronic
1190935884 X:54998803-54998825 GCCAGATTGCTTTCCAGTAAGGG - Intergenic
1192866720 X:75141761-75141783 GACAAACCGCCCTCCAGAAAGGG + Intronic
1193031271 X:76900865-76900887 GCCACACTGTCTTCCACAAAGGG - Intergenic
1193133470 X:77943995-77944017 GCAAATTTGCCTTTCAAAAAAGG + Intronic
1196069292 X:111501835-111501857 AACCAATTGCCTTCCAAAAAGGG - Intergenic
1197292208 X:124672511-124672533 GCCACATTGCCCTCCAAAAAAGG - Intronic
1198261352 X:134967556-134967578 GTCAAATTATTTTCCAGAAAGGG + Intergenic
1201490620 Y:14537278-14537300 GGAAAATTCCCTTCCAGGAAAGG - Intronic
1201755638 Y:17483149-17483171 GCCCAAGTGCATTCCATAAAAGG - Intergenic
1201845914 Y:18422836-18422858 GCCCAAGTGCATTCCATAAAAGG + Intergenic