ID: 922539461

View in Genome Browser
Species Human (GRCh38)
Location 1:226408047-226408069
Sequence GGCCGGTGCGGCGTGTTCGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 53}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922539461_922539470 10 Left 922539461 1:226408047-226408069 CCACCGAACACGCCGCACCGGCC 0: 1
1: 0
2: 0
3: 10
4: 53
Right 922539470 1:226408080-226408102 CCTGATAGATTGCTGATGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 112
922539461_922539472 17 Left 922539461 1:226408047-226408069 CCACCGAACACGCCGCACCGGCC 0: 1
1: 0
2: 0
3: 10
4: 53
Right 922539472 1:226408087-226408109 GATTGCTGATGCCTGGCCGCGGG 0: 1
1: 0
2: 0
3: 7
4: 87
922539461_922539474 28 Left 922539461 1:226408047-226408069 CCACCGAACACGCCGCACCGGCC 0: 1
1: 0
2: 0
3: 10
4: 53
Right 922539474 1:226408098-226408120 CCTGGCCGCGGGAACGCCCACGG 0: 1
1: 0
2: 0
3: 7
4: 77
922539461_922539471 16 Left 922539461 1:226408047-226408069 CCACCGAACACGCCGCACCGGCC 0: 1
1: 0
2: 0
3: 10
4: 53
Right 922539471 1:226408086-226408108 AGATTGCTGATGCCTGGCCGCGG 0: 1
1: 0
2: 1
3: 11
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922539461 Original CRISPR GGCCGGTGCGGCGTGTTCGG TGG (reversed) Exonic
900171990 1:1273786-1273808 CGGCGCTGCGGCGGGTTCGGTGG - Exonic
900301639 1:1980894-1980916 GGCTGGGGCGGCCTGTTCTGTGG + Intronic
901483235 1:9540033-9540055 GGCCGGTGAGTGGTGCTCGGCGG + Intronic
914921956 1:151853327-151853349 GGCAGGTGGGCAGTGTTCGGAGG - Intronic
922539461 1:226408047-226408069 GGCCGGTGCGGCGTGTTCGGTGG - Exonic
1076759812 10:132597773-132597795 GGCCTGTGGTGCGTGTTCCGGGG + Intronic
1076759822 10:132597819-132597841 GGCCTGTGGTGCGTGTTCCGGGG + Intronic
1077140153 11:1020692-1020714 GGCAGCTGCGGCGTGGTGGGTGG + Exonic
1077505938 11:2929935-2929957 GGCCGTTCCGTCCTGTTCGGGGG + Intergenic
1077898791 11:6473922-6473944 GGCCTGTGCGGCTAGTCCGGCGG - Intronic
1081863486 11:46347388-46347410 GGCCGAGGGGGCGTGCTCGGCGG + Intronic
1088893029 11:114059509-114059531 GGCCAGTGCGGGGTGGTGGGCGG + Intergenic
1090194084 11:124800203-124800225 GGGCAGTGCGGCGGGCTCGGGGG - Exonic
1113312030 13:109140983-109141005 GGCGGGGGCGGCGTGGACGGCGG - Exonic
1114656053 14:24316290-24316312 GGCCGGTGCGGCGGCTGCGGCGG - Exonic
1117156821 14:52950636-52950658 GGCCGGCGCTGCGAATTCGGTGG - Intronic
1122631682 14:103110127-103110149 GGCCGGGGCGGCGGGTGCGGAGG + Exonic
1135051209 16:19194452-19194474 GGCCAGGGCAGCGTGTTCTGGGG + Intronic
1140223083 16:73058131-73058153 GGCCCGCGCGGCGAGTTTGGAGG - Intronic
1142390377 16:89796001-89796023 GGCAGGTTCGGAGTGTTCAGTGG - Exonic
1142891629 17:2947724-2947746 GGGCAGTGTGGCGTGCTCGGTGG + Intronic
1142940814 17:3378609-3378631 GGCCAGGGCTGCGTGCTCGGTGG - Intergenic
1143400647 17:6640203-6640225 GGTCGGGGCGGGGGGTTCGGCGG - Intronic
1143627951 17:8121790-8121812 GGCCGGTGCGGCGGGGTCCAGGG + Exonic
1145995508 17:29102819-29102841 GCCCCGTGGGGCGTGTGCGGTGG - Intronic
1146803837 17:35849356-35849378 GGCCAGTGAGGCGTGGTCAGTGG + Intronic
1147155238 17:38541440-38541462 GGCTGGGGCAGCGTGGTCGGGGG + Intronic
1147338143 17:39739158-39739180 GGGCGGTGCGGCTAGTTGGGGGG - Intronic
1152552316 17:81035704-81035726 GGCCGGGGCGGCGGGGGCGGCGG + Intronic
1159966148 18:74597952-74597974 GGCCGGGGCGGGGGGTTTGGAGG + Intronic
1160783424 19:888753-888775 AGCCGGTGCTGCGTGTACTGCGG + Intronic
1160861280 19:1238102-1238124 GGCCGCCGCGGCGGGTGCGGGGG - Intergenic
1162553904 19:11374713-11374735 GGGCGGTGCGGCCTGGTCCGGGG + Exonic
1162935330 19:13978997-13979019 GGCCGGGGCGGCGGCTCCGGCGG + Intronic
1168515157 19:57004635-57004657 GGCCGGGGTGGCGTGCCCGGTGG - Intergenic
925288556 2:2731290-2731312 GGACGGTGCGGGGTGTGCAGAGG - Intergenic
929775744 2:44929603-44929625 GGGCGGTGCGGCCTGCTCGGAGG - Intergenic
944159066 2:196639798-196639820 GGCTGGTGAGGGGTGGTCGGAGG + Intronic
947593055 2:231395921-231395943 GGCCGGCGCGGCGCGCGCGGGGG - Intronic
1175868838 20:62197509-62197531 GGCCTGTGTGGTGGGTTCGGTGG + Intronic
1176113152 20:63419593-63419615 AGTCCGTGCGGCGTGTTCCGCGG + Intronic
1176145042 20:63561805-63561827 GGCAGGTGCGCCGGGGTCGGCGG - Exonic
1180631360 22:17232454-17232476 GGCCGGTGCGGCGGGGGCGGGGG - Intergenic
1182249924 22:28992163-28992185 GGCCGGGGCGGGGGGTTGGGGGG - Intronic
954392655 3:50275645-50275667 GGCAGGTGGGGCGTCTTCTGGGG - Intronic
985640416 5:1061056-1061078 GGCAGGTGCGGCGGGTGCGGCGG - Intronic
985640462 5:1061218-1061240 GGCAGGTACGGCGGGTGCGGTGG - Intronic
985640504 5:1061380-1061402 GGCAGGTACGGCGGGTGCGGCGG - Intronic
985640539 5:1061506-1061528 GGCAGGTGCGGCGGGTGCGGCGG - Intronic
996900411 5:128537485-128537507 GGCCGGGGCGGCTTGGGCGGAGG + Exonic
1006676265 6:35765862-35765884 GACAGGTGCGGCGTGTGCCGGGG - Intergenic
1010703166 6:79077290-79077312 GGCCGGCGCGGGGTCTGCGGGGG - Intronic
1013619285 6:111872877-111872899 GGCGGGGGCGGCGTGCGCGGGGG + Intronic
1013619385 6:111873161-111873183 GGGCGGTGCGGCGCGGGCGGCGG + Exonic
1019629972 7:2043798-2043820 GGGCAGTGCGGGGTGTTGGGAGG - Intronic
1022943043 7:35257725-35257747 GGCCGCTGCGGCGCGTTCCCGGG + Intergenic
1033052883 7:138022210-138022232 GGCCGGGGCGGGGTGTTGGGGGG + Intronic
1033248285 7:139736901-139736923 GGCCTGTGTGGCTTGTTTGGAGG - Intronic
1037901850 8:22693212-22693234 GGGGGGTGGGGCGTGTGCGGGGG + Exonic
1042956762 8:74259452-74259474 GGCCAGCGCGGCCTGGTCGGCGG + Exonic
1049673117 8:143878402-143878424 GGCGGGTGCGGCGGGTGCGGCGG - Intronic
1049673120 8:143878411-143878433 GGCGGGTGCGGCGGGTGCGGCGG - Intronic
1049673123 8:143878420-143878442 GGCAGGTGCGGCGGGTGCGGCGG - Exonic
1062574558 9:137200206-137200228 GGCCGGGGCGGCGCGGGCGGCGG + Exonic