ID: 922539914

View in Genome Browser
Species Human (GRCh38)
Location 1:226410799-226410821
Sequence GGGCTTCATGGACCACCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922539909_922539914 -2 Left 922539909 1:226410778-226410800 CCACAATATTTATTCTGGAAAGG No data
Right 922539914 1:226410799-226410821 GGGCTTCATGGACCACCAAAGGG No data
922539908_922539914 1 Left 922539908 1:226410775-226410797 CCTCCACAATATTTATTCTGGAA No data
Right 922539914 1:226410799-226410821 GGGCTTCATGGACCACCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922539914 Original CRISPR GGGCTTCATGGACCACCAAA GGG Intergenic
No off target data available for this crispr