ID: 922542117

View in Genome Browser
Species Human (GRCh38)
Location 1:226427464-226427486
Sequence ATGTGGGCCCCTGTGGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922542117_922542120 -10 Left 922542117 1:226427464-226427486 CCTGGGCCCACAGGGGCCCACAT No data
Right 922542120 1:226427477-226427499 GGGCCCACATATAGAGCCATTGG No data
922542117_922542123 -5 Left 922542117 1:226427464-226427486 CCTGGGCCCACAGGGGCCCACAT No data
Right 922542123 1:226427482-226427504 CACATATAGAGCCATTGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922542117 Original CRISPR ATGTGGGCCCCTGTGGGCCC AGG (reversed) Intergenic
No off target data available for this crispr