ID: 922546231 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:226459308-226459330 |
| Sequence | GATGGTGCCCATCCACGTTG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 922546231_922546235 | 10 | Left | 922546231 | 1:226459308-226459330 | CCTCAACGTGGATGGGCACCATC | No data | ||
| Right | 922546235 | 1:226459341-226459363 | CCAGCCCAGCTAGAAAAAGCAGG | No data | ||||
| 922546231_922546238 | 20 | Left | 922546231 | 1:226459308-226459330 | CCTCAACGTGGATGGGCACCATC | No data | ||
| Right | 922546238 | 1:226459351-226459373 | TAGAAAAAGCAGGAAGAAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 922546231 | Original CRISPR | GATGGTGCCCATCCACGTTG AGG (reversed) | Intergenic | ||