ID: 922546238

View in Genome Browser
Species Human (GRCh38)
Location 1:226459351-226459373
Sequence TAGAAAAAGCAGGAAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922546231_922546238 20 Left 922546231 1:226459308-226459330 CCTCAACGTGGATGGGCACCATC No data
Right 922546238 1:226459351-226459373 TAGAAAAAGCAGGAAGAAGAAGG No data
922546229_922546238 25 Left 922546229 1:226459303-226459325 CCCATCCTCAACGTGGATGGGCA No data
Right 922546238 1:226459351-226459373 TAGAAAAAGCAGGAAGAAGAAGG No data
922546233_922546238 2 Left 922546233 1:226459326-226459348 CCATCTAATTGGCTGCCAGCCCA No data
Right 922546238 1:226459351-226459373 TAGAAAAAGCAGGAAGAAGAAGG No data
922546230_922546238 24 Left 922546230 1:226459304-226459326 CCATCCTCAACGTGGATGGGCAC No data
Right 922546238 1:226459351-226459373 TAGAAAAAGCAGGAAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922546238 Original CRISPR TAGAAAAAGCAGGAAGAAGA AGG Intergenic