ID: 922547856

View in Genome Browser
Species Human (GRCh38)
Location 1:226471958-226471980
Sequence GGTAATATATGTAAAGTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922547854_922547856 7 Left 922547854 1:226471928-226471950 CCTCTGCAGATCAATTTGAAAAT No data
Right 922547856 1:226471958-226471980 GGTAATATATGTAAAGTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922547856 Original CRISPR GGTAATATATGTAAAGTTGT TGG Intergenic
No off target data available for this crispr