ID: 922550161

View in Genome Browser
Species Human (GRCh38)
Location 1:226488858-226488880
Sequence GTTCCTGTCCTTCCTAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922550158_922550161 -4 Left 922550158 1:226488839-226488861 CCAGAACAGCCCGGGATCTGTTC No data
Right 922550161 1:226488858-226488880 GTTCCTGTCCTTCCTAGAACAGG No data
922550155_922550161 17 Left 922550155 1:226488818-226488840 CCTGAGATAAGGAAGAACTGGCC No data
Right 922550161 1:226488858-226488880 GTTCCTGTCCTTCCTAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922550161 Original CRISPR GTTCCTGTCCTTCCTAGAAC AGG Intergenic
No off target data available for this crispr