ID: 922550281

View in Genome Browser
Species Human (GRCh38)
Location 1:226489528-226489550
Sequence AGGATCTACCTGGGTGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922550281_922550292 17 Left 922550281 1:226489528-226489550 CCCTGCACACCCAGGTAGATCCT No data
Right 922550292 1:226489568-226489590 TCCAGCCGCCCACAGGTACGGGG No data
922550281_922550291 16 Left 922550281 1:226489528-226489550 CCCTGCACACCCAGGTAGATCCT No data
Right 922550291 1:226489567-226489589 TTCCAGCCGCCCACAGGTACGGG No data
922550281_922550290 15 Left 922550281 1:226489528-226489550 CCCTGCACACCCAGGTAGATCCT No data
Right 922550290 1:226489566-226489588 CTTCCAGCCGCCCACAGGTACGG No data
922550281_922550288 10 Left 922550281 1:226489528-226489550 CCCTGCACACCCAGGTAGATCCT No data
Right 922550288 1:226489561-226489583 TGCCACTTCCAGCCGCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922550281 Original CRISPR AGGATCTACCTGGGTGTGCA GGG (reversed) Intergenic
No off target data available for this crispr