ID: 922554981

View in Genome Browser
Species Human (GRCh38)
Location 1:226526165-226526187
Sequence GTGGAGAGAGGCCCTGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922554981_922554989 26 Left 922554981 1:226526165-226526187 CCTTTTCCAGGGCCTCTCTCCAC No data
Right 922554989 1:226526214-226526236 ACTTGAGCTTCCTTCAGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922554981 Original CRISPR GTGGAGAGAGGCCCTGGAAA AGG (reversed) Intergenic
No off target data available for this crispr