ID: 922556028

View in Genome Browser
Species Human (GRCh38)
Location 1:226532727-226532749
Sequence GGCTGTCTGCATGGCTCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922556028_922556036 19 Left 922556028 1:226532727-226532749 CCACTTGAGCCATGCAGACAGCC No data
Right 922556036 1:226532769-226532791 TGTCAGAGTGTCTAGATAAAAGG No data
922556028_922556037 26 Left 922556028 1:226532727-226532749 CCACTTGAGCCATGCAGACAGCC No data
Right 922556037 1:226532776-226532798 GTGTCTAGATAAAAGGATCCTGG No data
922556028_922556031 -6 Left 922556028 1:226532727-226532749 CCACTTGAGCCATGCAGACAGCC No data
Right 922556031 1:226532744-226532766 ACAGCCCTTCCTGGCATCCTAGG No data
922556028_922556038 27 Left 922556028 1:226532727-226532749 CCACTTGAGCCATGCAGACAGCC No data
Right 922556038 1:226532777-226532799 TGTCTAGATAAAAGGATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922556028 Original CRISPR GGCTGTCTGCATGGCTCAAG TGG (reversed) Intergenic
No off target data available for this crispr