ID: 922556030

View in Genome Browser
Species Human (GRCh38)
Location 1:226532736-226532758
Sequence GCCAGGAAGGGCTGTCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922556030_922556038 18 Left 922556030 1:226532736-226532758 CCATGCAGACAGCCCTTCCTGGC No data
Right 922556038 1:226532777-226532799 TGTCTAGATAAAAGGATCCTGGG No data
922556030_922556036 10 Left 922556030 1:226532736-226532758 CCATGCAGACAGCCCTTCCTGGC No data
Right 922556036 1:226532769-226532791 TGTCAGAGTGTCTAGATAAAAGG No data
922556030_922556037 17 Left 922556030 1:226532736-226532758 CCATGCAGACAGCCCTTCCTGGC No data
Right 922556037 1:226532776-226532798 GTGTCTAGATAAAAGGATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922556030 Original CRISPR GCCAGGAAGGGCTGTCTGCA TGG (reversed) Intergenic
No off target data available for this crispr