ID: 922556031

View in Genome Browser
Species Human (GRCh38)
Location 1:226532744-226532766
Sequence ACAGCCCTTCCTGGCATCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922556025_922556031 16 Left 922556025 1:226532705-226532727 CCTCTTCCCACTGGCTGGTGCAC No data
Right 922556031 1:226532744-226532766 ACAGCCCTTCCTGGCATCCTAGG No data
922556027_922556031 9 Left 922556027 1:226532712-226532734 CCACTGGCTGGTGCACCACTTGA No data
Right 922556031 1:226532744-226532766 ACAGCCCTTCCTGGCATCCTAGG No data
922556022_922556031 21 Left 922556022 1:226532700-226532722 CCTTCCCTCTTCCCACTGGCTGG No data
Right 922556031 1:226532744-226532766 ACAGCCCTTCCTGGCATCCTAGG No data
922556024_922556031 17 Left 922556024 1:226532704-226532726 CCCTCTTCCCACTGGCTGGTGCA No data
Right 922556031 1:226532744-226532766 ACAGCCCTTCCTGGCATCCTAGG No data
922556028_922556031 -6 Left 922556028 1:226532727-226532749 CCACTTGAGCCATGCAGACAGCC No data
Right 922556031 1:226532744-226532766 ACAGCCCTTCCTGGCATCCTAGG No data
922556026_922556031 10 Left 922556026 1:226532711-226532733 CCCACTGGCTGGTGCACCACTTG No data
Right 922556031 1:226532744-226532766 ACAGCCCTTCCTGGCATCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922556031 Original CRISPR ACAGCCCTTCCTGGCATCCT AGG Intergenic
No off target data available for this crispr