ID: 922556032

View in Genome Browser
Species Human (GRCh38)
Location 1:226532748-226532770
Sequence CATTCCTAGGATGCCAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922556032_922556037 5 Left 922556032 1:226532748-226532770 CCCTTCCTGGCATCCTAGGAATG No data
Right 922556037 1:226532776-226532798 GTGTCTAGATAAAAGGATCCTGG No data
922556032_922556038 6 Left 922556032 1:226532748-226532770 CCCTTCCTGGCATCCTAGGAATG No data
Right 922556038 1:226532777-226532799 TGTCTAGATAAAAGGATCCTGGG No data
922556032_922556036 -2 Left 922556032 1:226532748-226532770 CCCTTCCTGGCATCCTAGGAATG No data
Right 922556036 1:226532769-226532791 TGTCAGAGTGTCTAGATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922556032 Original CRISPR CATTCCTAGGATGCCAGGAA GGG (reversed) Intergenic
No off target data available for this crispr