ID: 922556036

View in Genome Browser
Species Human (GRCh38)
Location 1:226532769-226532791
Sequence TGTCAGAGTGTCTAGATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922556030_922556036 10 Left 922556030 1:226532736-226532758 CCATGCAGACAGCCCTTCCTGGC No data
Right 922556036 1:226532769-226532791 TGTCAGAGTGTCTAGATAAAAGG No data
922556028_922556036 19 Left 922556028 1:226532727-226532749 CCACTTGAGCCATGCAGACAGCC No data
Right 922556036 1:226532769-226532791 TGTCAGAGTGTCTAGATAAAAGG No data
922556033_922556036 -3 Left 922556033 1:226532749-226532771 CCTTCCTGGCATCCTAGGAATGT No data
Right 922556036 1:226532769-226532791 TGTCAGAGTGTCTAGATAAAAGG No data
922556032_922556036 -2 Left 922556032 1:226532748-226532770 CCCTTCCTGGCATCCTAGGAATG No data
Right 922556036 1:226532769-226532791 TGTCAGAGTGTCTAGATAAAAGG No data
922556034_922556036 -7 Left 922556034 1:226532753-226532775 CCTGGCATCCTAGGAATGTCAGA No data
Right 922556036 1:226532769-226532791 TGTCAGAGTGTCTAGATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922556036 Original CRISPR TGTCAGAGTGTCTAGATAAA AGG Intergenic
No off target data available for this crispr