ID: 922556037

View in Genome Browser
Species Human (GRCh38)
Location 1:226532776-226532798
Sequence GTGTCTAGATAAAAGGATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922556035_922556037 -8 Left 922556035 1:226532761-226532783 CCTAGGAATGTCAGAGTGTCTAG No data
Right 922556037 1:226532776-226532798 GTGTCTAGATAAAAGGATCCTGG No data
922556030_922556037 17 Left 922556030 1:226532736-226532758 CCATGCAGACAGCCCTTCCTGGC No data
Right 922556037 1:226532776-226532798 GTGTCTAGATAAAAGGATCCTGG No data
922556034_922556037 0 Left 922556034 1:226532753-226532775 CCTGGCATCCTAGGAATGTCAGA No data
Right 922556037 1:226532776-226532798 GTGTCTAGATAAAAGGATCCTGG No data
922556032_922556037 5 Left 922556032 1:226532748-226532770 CCCTTCCTGGCATCCTAGGAATG No data
Right 922556037 1:226532776-226532798 GTGTCTAGATAAAAGGATCCTGG No data
922556033_922556037 4 Left 922556033 1:226532749-226532771 CCTTCCTGGCATCCTAGGAATGT No data
Right 922556037 1:226532776-226532798 GTGTCTAGATAAAAGGATCCTGG No data
922556028_922556037 26 Left 922556028 1:226532727-226532749 CCACTTGAGCCATGCAGACAGCC No data
Right 922556037 1:226532776-226532798 GTGTCTAGATAAAAGGATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922556037 Original CRISPR GTGTCTAGATAAAAGGATCC TGG Intergenic
No off target data available for this crispr