ID: 922558154

View in Genome Browser
Species Human (GRCh38)
Location 1:226548762-226548784
Sequence TCCGTGCGCCGCGCGGCTCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 68}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922558154_922558159 5 Left 922558154 1:226548762-226548784 CCGCGAGCCGCGCGGCGCACGGA 0: 1
1: 0
2: 0
3: 7
4: 68
Right 922558159 1:226548790-226548812 GCGGCCGCCTGAGCTCGGCGCGG 0: 1
1: 0
2: 1
3: 10
4: 156
922558154_922558162 12 Left 922558154 1:226548762-226548784 CCGCGAGCCGCGCGGCGCACGGA 0: 1
1: 0
2: 0
3: 7
4: 68
Right 922558162 1:226548797-226548819 CCTGAGCTCGGCGCGGAGCCCGG 0: 1
1: 0
2: 1
3: 22
4: 196
922558154_922558158 0 Left 922558154 1:226548762-226548784 CCGCGAGCCGCGCGGCGCACGGA 0: 1
1: 0
2: 0
3: 7
4: 68
Right 922558158 1:226548785-226548807 GCACGGCGGCCGCCTGAGCTCGG 0: 1
1: 0
2: 1
3: 12
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922558154 Original CRISPR TCCGTGCGCCGCGCGGCTCG CGG (reversed) Intergenic
906508038 1:46394442-46394464 TCCGGGCGCCGGACGGCGCGGGG + Exonic
907689155 1:56645264-56645286 CCCGCGCCCCTCGCGGCTCGGGG + Intronic
912401485 1:109397501-109397523 CCCGTGCGCCCCGCGACTCCCGG - Intronic
912878955 1:113390407-113390429 GCCGGGCGCCGCGCGGCGGGAGG + Intergenic
915345412 1:155194698-155194720 CTCGGGCGCCGCGCGGCGCGCGG - Intergenic
922558153 1:226548761-226548783 TCCGCGAGCCGCGCGGCGCACGG + Intergenic
922558154 1:226548762-226548784 TCCGTGCGCCGCGCGGCTCGCGG - Intergenic
1070071706 10:73096575-73096597 TCCCTGCGCCACGCGACTCCCGG - Intronic
1073125567 10:101146785-101146807 TCCGGGCGCCGCGCGGTGCCGGG - Intergenic
1073251073 10:102120596-102120618 TGCGTGCGCCGCGCGGCGGGCGG + Intergenic
1076374042 10:129971831-129971853 TACGGGCGCCGCGCGGCTCCGGG + Intergenic
1083329634 11:61891527-61891549 AGCGTGCGCCTCCCGGCTCGCGG + Exonic
1083335170 11:61917728-61917750 TCTGAGCGCGGCGCGGCCCGCGG - Intronic
1083727969 11:64638146-64638168 CCTGTGCGCCGCGGGCCTCGGGG - Intronic
1084516022 11:69638371-69638393 GCTGCGCGCCGCGGGGCTCGGGG - Intergenic
1084758412 11:71252828-71252850 TCCGTGAGCCACGCAGCCCGGGG - Intergenic
1096149072 12:49297425-49297447 GGCGGGCGCTGCGCGGCTCGAGG + Exonic
1098963625 12:76763970-76763992 GGCGTGGGCCCCGCGGCTCGGGG - Exonic
1099956186 12:89353966-89353988 TCCGTCCGCCCCGCGGCGCCTGG - Intergenic
1105472059 13:20703720-20703742 CCCGTGCGGCCCCCGGCTCGGGG + Intronic
1108363843 13:49691355-49691377 GCTGTGCGCCGCGCTGCTGGCGG - Exonic
1117875965 14:60249834-60249856 GCCGTCCGCCGCCCGGCTCGGGG - Intronic
1117963963 14:61188508-61188530 TCCGGGCGCCTCCCGGCTCCGGG + Intronic
1118404934 14:65413234-65413256 GCCGGGCCCCGCGCGCCTCGGGG + Intronic
1122779776 14:104138743-104138765 TCTGTGCGCTGCGCAGCCCGCGG + Exonic
1125200748 15:37099056-37099078 GCCGTGGCTCGCGCGGCTCGGGG - Intronic
1132498865 16:275961-275983 CCCGGGCGCGGCGCGGCGCGGGG - Intronic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1141538467 16:84699950-84699972 TCCCCGCGCCCCGCGGCGCGCGG + Intergenic
1141538468 16:84699951-84699973 GCCGCGCGCCGCGGGGCGCGGGG - Intergenic
1145034881 17:19533998-19534020 TCCGTGGGTCGCGCTGCTTGCGG + Exonic
1145884374 17:28372098-28372120 GCCGGGCGCCGAGCGGCTGGCGG + Exonic
1148838416 17:50478858-50478880 TCAGTGCGCCGCGCTGCGCTGGG + Exonic
1156144456 18:34159227-34159249 TCCGGGCGCCGCGCTCCGCGAGG + Intronic
1158589643 18:58768664-58768686 TCCGTGCGCTGCGCAGCTGCAGG - Intergenic
1160204554 18:76822435-76822457 TCCGAGCGCCGCCGGGCTCACGG - Intergenic
1160703679 19:519426-519448 CCCGTGGGCCGCGCGGATCCGGG + Exonic
1167613407 19:50518064-50518086 TCCGTGGGCCGCGAGGAGCGCGG + Exonic
925169601 2:1743165-1743187 TCCCTCCGCCCCGCGGCTCCAGG - Intronic
934028072 2:88017326-88017348 TGCGTGCTCCGCGCGGTTGGAGG + Intergenic
934882312 2:97995313-97995335 TCCGTGCGGCGGGCGCCGCGAGG + Intronic
935137655 2:100321829-100321851 CCGCGGCGCCGCGCGGCTCGGGG - Exonic
935301565 2:101697752-101697774 GCCCCGCGCCGCGCGCCTCGAGG - Intronic
939003991 2:136765395-136765417 TCCGAGAGCCGCGGGGCGCGGGG - Intergenic
939629400 2:144515907-144515929 TCCCCGCGCCGCGCAGCTCTGGG + Intronic
944811191 2:203328673-203328695 GCCGGGGGCCGCGCGCCTCGGGG + Intronic
946326080 2:218985302-218985324 TCCGGCCCCCGCGCGGCCCGGGG + Exonic
946354638 2:219177088-219177110 TCCGTGCGACGCTCACCTCGCGG + Intronic
948677930 2:239610108-239610130 TCTGTGCTCCGCGAGGCGCGAGG + Intergenic
1169345093 20:4823103-4823125 CCCGGGAGCCCCGCGGCTCGGGG + Intronic
1169483452 20:6006257-6006279 TGCGCGTGGCGCGCGGCTCGTGG + Exonic
1173454026 20:43189566-43189588 TCCGAGGGCCCCGCGGCTGGGGG + Intronic
1175429481 20:58891552-58891574 TCCGCGCGCCCCGCGGCCCGCGG + Intronic
1179529758 21:42010494-42010516 TCCGTTCGGCGCGCGGCTCCGGG - Intergenic
1181082699 22:20425255-20425277 GCCGGGCACCGCGCGGCTAGCGG - Exonic
1181283517 22:21736119-21736141 TCCGAGCGCGGCGCTCCTCGCGG - Intergenic
1185055494 22:48576602-48576624 TCCGCGCTCTGCCCGGCTCGCGG + Intronic
950316242 3:12004354-12004376 CCCGCGCGGCGCGAGGCTCGCGG - Intergenic
952744501 3:36764427-36764449 GCCGGGCGCTGCGCGGCGCGGGG - Intergenic
960955507 3:123027895-123027917 TCCGCGCGCCTCGAGGCTGGCGG - Intronic
970637255 4:18022326-18022348 TCTCTGCGCCGCGCCGCTGGGGG + Intergenic
983904687 4:173170031-173170053 TCCCCGCGCGGCGCGGCTCCGGG - Intronic
984734642 4:183098549-183098571 GCTTTCCGCCGCGCGGCTCGCGG + Intergenic
1005992848 6:30914241-30914263 CCCATGCGCCGCGCGGCTCCAGG + Intronic
1018960195 6:168441982-168442004 CTCGTGCGCCGCGCGGATCCCGG + Intronic
1019828307 7:3301549-3301571 TCCGTCCGGCGCGGCGCTCGGGG + Exonic
1022305913 7:29146449-29146471 TCCTTGCGCGCCGCGGCTCAGGG - Intronic
1022528386 7:31052590-31052612 TCCCCGCGCCGCGCGGGCCGCGG + Exonic
1022528387 7:31052591-31052613 TCCGCGGCCCGCGCGGCGCGGGG - Exonic
1026833692 7:73624518-73624540 TCCCTGCTCCGCGCAGCGCGGGG + Exonic
1029496371 7:100897171-100897193 TCCCTGGGCCGCGCGGTTCCCGG + Intergenic
1048989861 8:139754948-139754970 TCCGTGTGCCGCACAGCTCCTGG - Intronic
1061052395 9:128204206-128204228 TCCGTGCGCAGCGCGGCGAGGGG + Intronic
1062549036 9:137077620-137077642 TCCGCCAGCAGCGCGGCTCGTGG - Exonic
1062592213 9:137279379-137279401 CCTGTGCGGCGCGCGCCTCGGGG - Exonic
1185464419 X:346301-346323 TCCGTGCGGGGCGAGGCTCCTGG - Intronic