ID: 922558837

View in Genome Browser
Species Human (GRCh38)
Location 1:226552470-226552492
Sequence ACAAACTCTCTGGCCATGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922558837_922558842 -10 Left 922558837 1:226552470-226552492 CCCAACATGGCCAGAGAGTTTGT No data
Right 922558842 1:226552483-226552505 GAGAGTTTGTCTAGTGGTCAGGG 0: 1
1: 0
2: 2
3: 8
4: 87
922558837_922558843 -9 Left 922558837 1:226552470-226552492 CCCAACATGGCCAGAGAGTTTGT No data
Right 922558843 1:226552484-226552506 AGAGTTTGTCTAGTGGTCAGGGG 0: 1
1: 0
2: 0
3: 10
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922558837 Original CRISPR ACAAACTCTCTGGCCATGTT GGG (reversed) Intronic
No off target data available for this crispr