ID: 922558842

View in Genome Browser
Species Human (GRCh38)
Location 1:226552483-226552505
Sequence GAGAGTTTGTCTAGTGGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 87}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922558837_922558842 -10 Left 922558837 1:226552470-226552492 CCCAACATGGCCAGAGAGTTTGT No data
Right 922558842 1:226552483-226552505 GAGAGTTTGTCTAGTGGTCAGGG 0: 1
1: 0
2: 2
3: 8
4: 87
922558836_922558842 -9 Left 922558836 1:226552469-226552491 CCCCAACATGGCCAGAGAGTTTG 0: 1
1: 0
2: 1
3: 17
4: 167
Right 922558842 1:226552483-226552505 GAGAGTTTGTCTAGTGGTCAGGG 0: 1
1: 0
2: 2
3: 8
4: 87
922558834_922558842 16 Left 922558834 1:226552444-226552466 CCTGTAATGAAAGTTCATTGTTA 0: 1
1: 0
2: 0
3: 14
4: 184
Right 922558842 1:226552483-226552505 GAGAGTTTGTCTAGTGGTCAGGG 0: 1
1: 0
2: 2
3: 8
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922558842 Original CRISPR GAGAGTTTGTCTAGTGGTCA GGG Intronic
900663015 1:3795477-3795499 GAGAGTGAGTCTGGTGGTGAAGG - Intronic
900965547 1:5955754-5955776 GAGAGGTTGTCAAGGGGTCATGG + Intronic
901213151 1:7537709-7537731 GAGAGTGTGTCTATTTGTCTGGG - Intronic
907023828 1:51095321-51095343 AAGACTTTGTCTTGTGGCCAGGG + Intergenic
911092052 1:94025338-94025360 GGAAGTTTCTCTAGTGGTCTAGG - Intronic
911888254 1:103331684-103331706 GAGATTTTTTCTAGTGTGCATGG - Intergenic
917677425 1:177333159-177333181 AAGTGTTTGGCTAGTGGTAACGG - Intergenic
922039513 1:221882836-221882858 GAGAGTCAGTATGGTGGTCAAGG + Intergenic
922239438 1:223746002-223746024 TTGAGTTTGTCCAGTGCTCAGGG + Intronic
922558842 1:226552483-226552505 GAGAGTTTGTCTAGTGGTCAGGG + Intronic
1063637507 10:7797677-7797699 GAGAGCTGGCCTTGTGGTCATGG + Intronic
1080189882 11:29531728-29531750 GATATTTTGTCTGGTGGGCATGG + Intergenic
1082249060 11:49960073-49960095 GAGTGTTTTTCTAGTGGCCAGGG + Intergenic
1083108882 11:60385720-60385742 GAGAGTTTCTCTAGTGCTCAGGG - Intronic
1083493245 11:63028360-63028382 GAGAGTGCGTCCAGAGGTCAAGG - Intergenic
1085297852 11:75441084-75441106 CAGAGCTTGCCGAGTGGTCAGGG + Intronic
1087417439 11:97875248-97875270 GAGATTTTGTCTACAGGCCAAGG - Intergenic
1089644767 11:119871562-119871584 GAGGGTTTGGCCAGTGGTCAGGG + Intergenic
1098394142 12:70000819-70000841 GACAGTGTGTGTAGTGGTTAAGG + Intergenic
1100702297 12:97161429-97161451 GGGAGCTTGTCTGGTGCTCAAGG + Intergenic
1102948081 12:117007645-117007667 GAGAATGAGTCAAGTGGTCATGG + Intronic
1106107951 13:26750638-26750660 CAGGGTTTGTCAAGTGTTCATGG + Intergenic
1107027532 13:35818175-35818197 GAGAATGGGTCTAGAGGTCATGG - Intronic
1108564397 13:51680830-51680852 GAAAATTTGTCTAGGGCTCAGGG - Intronic
1113032142 13:106005612-106005634 AAGAGTTTGTCTAATGGATATGG - Intergenic
1114334029 14:21669136-21669158 GAGACTTGCTTTAGTGGTCAAGG - Intergenic
1117205467 14:53438254-53438276 TAATGTTTGTCTAGTGCTCAGGG + Intergenic
1117237805 14:53797164-53797186 GAGAGTTTGCTGAGTGGTTAGGG - Intergenic
1119041384 14:71277585-71277607 TAAAGTTTGTCATGTGGTCATGG - Intergenic
1124954212 15:34349216-34349238 TAGAGCTTGCTTAGTGGTCAAGG + Intronic
1128328810 15:66742468-66742490 GAGGGTGTGTCTGGTGGTCTTGG + Intronic
1129179812 15:73866973-73866995 GTGAGTTTGGGTAGGGGTCAGGG + Intergenic
1131731276 15:95283864-95283886 AAGAGTTTGTCCAGGGGCCAAGG + Intergenic
1143697849 17:8633237-8633259 GAGAGTTTGAGTAGTGGGAAAGG - Intergenic
1147138709 17:38449682-38449704 GCGAGGTTGTGGAGTGGTCATGG + Intronic
1157024222 18:43823595-43823617 GACAGTTTGTATAATGGTTAAGG + Intergenic
1159029194 18:63213784-63213806 GAAAGAATGTCAAGTGGTCAGGG - Intronic
1159069751 18:63610607-63610629 GAGGGTTTCTGTAATGGTCAGGG + Intergenic
1161310490 19:3591314-3591336 CAGAGTTTGGCTTGTTGTCAGGG - Exonic
1166291494 19:41866480-41866502 GTGAGTCTGTCTATTGGTCCTGG + Intronic
1167254267 19:48417935-48417957 GGGAGGTTGTCTAATGGACAGGG + Intronic
1167941213 19:52946912-52946934 GCGAGTTTGTGCAGTTGTCAGGG + Intronic
1168002829 19:53463197-53463219 GCGAGTTTGTGCAGTTGTCAGGG - Intergenic
925080249 2:1057318-1057340 GAGAGTTGGTGTATTAGTCAGGG + Intronic
926053683 2:9761100-9761122 GAGGGTGTGGCTTGTGGTCAGGG + Intergenic
927292009 2:21413742-21413764 GAGAGTTTTTCTAGTGGACATGG + Intergenic
928472284 2:31586280-31586302 GAGATGTTGTCTAGGAGTCAGGG - Intergenic
929115793 2:38442957-38442979 GAGACTTTGTCTTATGGTAATGG - Intergenic
934899985 2:98151957-98151979 GAGCATTTTTCTAATGGTCATGG + Intronic
937440179 2:121908587-121908609 GAATGTGTGTCTAGTGGACAAGG - Intergenic
937841023 2:126524793-126524815 GAGAGTTAGTGTGCTGGTCAGGG - Intergenic
937954595 2:127415001-127415023 GAGAGATGGGCTGGTGGTCAGGG - Intergenic
939128729 2:138207764-138207786 GAGGGTGGGTCTAGTGGTCATGG + Intergenic
941220198 2:162768856-162768878 GAGAGGTTGGCTAGTGTTAAAGG + Intronic
942586117 2:177479784-177479806 GAGGGTTTGTTTAGTGGATATGG + Intronic
944874195 2:203944807-203944829 GAGTCTTTGTCTGGTGGTCTTGG + Intronic
946346062 2:219111473-219111495 TAGATTTTTTCTAGGGGTCAGGG - Intronic
947204497 2:227647971-227647993 GAGATTTTGTGCAGTGGTCCCGG - Intergenic
1169881082 20:10347710-10347732 GAGAGTGAGTCCTGTGGTCAAGG - Intergenic
1171781692 20:29424485-29424507 GAGACTCTGTCTATTGGTCTTGG + Intergenic
1174407892 20:50313882-50313904 AAGAGTTAGTCGGGTGGTCAAGG + Intergenic
1177732607 21:25047779-25047801 GAAAGTTTGACTGGTGATCAAGG - Intergenic
1181454422 22:23048343-23048365 GAGGGAAGGTCTAGTGGTCAAGG - Intergenic
955891551 3:63655414-63655436 GAGAGTTTGGCTAGTCATCTAGG - Intronic
956402228 3:68892518-68892540 TATAGCTTGTGTAGTGGTCAAGG - Intronic
957083816 3:75661873-75661895 GAGACTCTGTCTATTGGTCTTGG - Intergenic
960995716 3:123338936-123338958 CTGAGTTTTTCTAGTGGTCTAGG + Intronic
961902092 3:130223011-130223033 GACAGTTTGTCTAGAGGCCTAGG - Intergenic
962295408 3:134179620-134179642 GAGAGAAAGTCTAGTGGTCCAGG - Intronic
967094593 3:186166715-186166737 TAGAGTATGTCTAGGGGTGAGGG + Intronic
974778078 4:66513984-66514006 TAGAGTTTGAGTAGTAGTCAAGG - Intergenic
976270181 4:83222509-83222531 GGGAGTGTCTCTAGTTGTCAGGG - Intergenic
976293215 4:83443333-83443355 AAGAGTTTGTGTATAGGTCAGGG - Intronic
976899944 4:90160255-90160277 GACAGTCTGTCTGGAGGTCAGGG + Intronic
981572846 4:146171720-146171742 GAGAGGTTTTCTAGAGTTCACGG + Intergenic
1000554492 5:162708419-162708441 GAGAGCTGGTCCAGTGCTCAGGG - Intergenic
1003655481 6:8003208-8003230 GTGTGTGTGTCTAGTGGTGATGG + Intronic
1004115647 6:12764804-12764826 GAGAAAATGTCTAGAGGTCATGG + Intronic
1007175707 6:39895691-39895713 GAGATTTTGTCTACTAGTTACGG - Intronic
1008033989 6:46727022-46727044 GATATTTTATCTAGTGGTCAAGG - Intronic
1011555030 6:88564876-88564898 TAGAGTATGTGTATTGGTCAGGG - Intergenic
1015897840 6:138034416-138034438 GAGACTCTGGCTGGTGGTCAAGG - Intergenic
1017195576 6:151696640-151696662 TAGAGATTGTCTAGGGATCAAGG - Intronic
1029431199 7:100531895-100531917 GGGAGATTGTCTACTGGGCATGG - Intergenic
1035013360 7:155740742-155740764 CACAGTGTGGCTAGTGGTCAGGG + Intronic
1037436159 8:18865744-18865766 GAGATCTTGTCTAGTGGTAAAGG - Intronic
1040995711 8:53399870-53399892 GAGGGTTTGTATAGCAGTCATGG + Intergenic
1042104040 8:65305428-65305450 GAGATTTTGTCTTGTGCTCTGGG - Intergenic
1045025974 8:98086989-98087011 GAGAGAGTGGCTGGTGGTCAAGG + Intronic
1049486362 8:142865772-142865794 GAGAGTTTGGCTGGTGGCCAGGG - Intronic
1203441486 Un_GL000219v1:12698-12720 GAGACTCTGTCTATTGGTCTTGG + Intergenic
1203512295 Un_KI270741v1:131606-131628 GAGACTCTGTCTATTGGTCTTGG + Intergenic
1190530925 X:51375304-51375326 GAGATTTTGTCTACTGGAAATGG - Intergenic
1196899354 X:120367876-120367898 GAGAGTTTGTGGGATGGTCAGGG - Intronic
1197708934 X:129652819-129652841 GAGTGGTTGTCTATTGGCCAGGG + Intronic
1199207732 X:145168334-145168356 AAGAGTCTGTCCAGTGCTCAGGG + Intergenic
1200799558 Y:7373831-7373853 TATAGTTTGGCTAGTGGTCAGGG + Intergenic
1201531157 Y:14990918-14990940 GAGAGTTTGTCTGCTTCTCAGGG + Intergenic