ID: 922558843

View in Genome Browser
Species Human (GRCh38)
Location 1:226552484-226552506
Sequence AGAGTTTGTCTAGTGGTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 131}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922558834_922558843 17 Left 922558834 1:226552444-226552466 CCTGTAATGAAAGTTCATTGTTA 0: 1
1: 0
2: 0
3: 14
4: 184
Right 922558843 1:226552484-226552506 AGAGTTTGTCTAGTGGTCAGGGG 0: 1
1: 0
2: 0
3: 10
4: 131
922558837_922558843 -9 Left 922558837 1:226552470-226552492 CCCAACATGGCCAGAGAGTTTGT No data
Right 922558843 1:226552484-226552506 AGAGTTTGTCTAGTGGTCAGGGG 0: 1
1: 0
2: 0
3: 10
4: 131
922558838_922558843 -10 Left 922558838 1:226552471-226552493 CCAACATGGCCAGAGAGTTTGTC 0: 1
1: 0
2: 1
3: 15
4: 120
Right 922558843 1:226552484-226552506 AGAGTTTGTCTAGTGGTCAGGGG 0: 1
1: 0
2: 0
3: 10
4: 131
922558836_922558843 -8 Left 922558836 1:226552469-226552491 CCCCAACATGGCCAGAGAGTTTG 0: 1
1: 0
2: 1
3: 17
4: 167
Right 922558843 1:226552484-226552506 AGAGTTTGTCTAGTGGTCAGGGG 0: 1
1: 0
2: 0
3: 10
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922558843 Original CRISPR AGAGTTTGTCTAGTGGTCAG GGG Intronic
901213150 1:7537708-7537730 AGAGTGTGTCTATTTGTCTGGGG - Intronic
903137745 1:21320455-21320477 AGAGTTTGGCCAGAAGTCAGTGG + Intronic
907030632 1:51167709-51167731 AGAGTTCTTCTAGTTGTGAGTGG - Intergenic
907713976 1:56910726-56910748 AGACTTTGGCCTGTGGTCAGGGG - Intronic
915980524 1:160417121-160417143 GCAGTATGTCTAGGGGTCAGAGG + Intronic
916600180 1:166285521-166285543 AGAATTTTTCTAGTTCTCAGTGG + Intergenic
920363230 1:205433720-205433742 AGTGTTTGTTAAGTGGTCTGGGG - Intronic
922558843 1:226552484-226552506 AGAGTTTGTCTAGTGGTCAGGGG + Intronic
922745102 1:228038979-228039001 AGAGTTTTTCTCCTGGGCAGTGG + Intronic
922860212 1:228810128-228810150 GGAGTTTTTCCAGTGGTCAAAGG + Intergenic
924070502 1:240273544-240273566 AGAGCTAGTCTACTGGTTAGAGG + Intronic
1066299785 10:34086734-34086756 GCAGTTTGTCTCGTGGGCAGAGG - Intergenic
1073149119 10:101299665-101299687 AGGCTTAGTCTAGTGGTGAGGGG - Intergenic
1074555347 10:114484190-114484212 AGAGTTACTCTACTGGTAAGTGG - Intronic
1076862891 10:133150017-133150039 TGCGTTTCTCTAATGGTCAGTGG - Intergenic
1078491680 11:11775259-11775281 AGAGTTTGACAGGTGGTCAATGG + Intergenic
1081963529 11:47155403-47155425 ACAGGATGTCTAGTGTTCAGTGG + Intronic
1082848626 11:57745755-57745777 GGAGTTTGATTAGTGGGCAGTGG + Exonic
1087688380 11:101290850-101290872 AGGATTTTTCTAGTGGTTAGAGG + Intergenic
1089364270 11:117911509-117911531 AGAGTTTATCAGGTCGTCAGAGG - Intronic
1099488845 12:83262195-83262217 AGAGCTCCTCTAGTGGTCTGAGG + Intergenic
1102611700 12:114117959-114117981 AGGGTTTGTGTATTGGCCAGAGG - Intergenic
1113032141 13:106005611-106005633 AGAGTTTGTCTAATGGATATGGG - Intergenic
1113748845 13:112764867-112764889 AGAGGTTGGCTCATGGTCAGAGG - Intronic
1113831097 13:113296758-113296780 AGGGTTTGTCTTTTGGTGAGTGG - Intergenic
1114284470 14:21227192-21227214 AGTGTTTGTTTAGTGGGGAGAGG - Intronic
1116251146 14:42483654-42483676 AGAGTTTGTCTAGAGTTCTGTGG + Intergenic
1116402231 14:44522008-44522030 AGAGTTTGTGTAATGATTAGTGG - Intergenic
1119041383 14:71277584-71277606 AAAGTTTGTCATGTGGTCATGGG - Intergenic
1119472592 14:74909152-74909174 ATATTTTGGCCAGTGGTCAGAGG - Exonic
1119982835 14:79101593-79101615 AGAAGCTGTCTCGTGGTCAGAGG - Intronic
1120211066 14:81634321-81634343 AGAACATGTCTAGTGGTAAGAGG + Intergenic
1124954213 15:34349217-34349239 AGAGCTTGCTTAGTGGTCAAGGG + Intronic
1125176626 15:36830050-36830072 AGAGTAAGTCTGGAGGTCAGAGG + Intergenic
1126275925 15:46880912-46880934 AGAGCTTATCTACTGGTGAGAGG - Intergenic
1126304749 15:47242754-47242776 AGATTTTGTATAATGATCAGGGG - Intronic
1128446337 15:67764554-67764576 AGAATTTGTGTATTGTTCAGAGG - Intronic
1129013183 15:72441424-72441446 TGCATTTCTCTAGTGGTCAGTGG + Intergenic
1129179813 15:73866974-73866996 TGAGTTTGGGTAGGGGTCAGGGG + Intergenic
1131731277 15:95283865-95283887 AGAGTTTGTCCAGGGGCCAAGGG + Intergenic
1132498397 16:274411-274433 AGAGACTGGCCAGTGGTCAGTGG - Intronic
1133007872 16:2894736-2894758 TGCTTTTGTTTAGTGGTCAGAGG + Intronic
1135240345 16:20801527-20801549 AGAGTTTATTTAGTGGAAAGAGG + Intronic
1135664240 16:24322432-24322454 AGAGTGTGTTTAGTGGGGAGGGG - Intronic
1135702210 16:24642343-24642365 AGGGATTGAGTAGTGGTCAGTGG + Intergenic
1140431019 16:74903225-74903247 TGAGTTTGTGCAGTGCTCAGTGG + Intronic
1143822934 17:9579263-9579285 AGATTTTGACTAGGAGTCAGCGG + Intronic
1146270152 17:31479713-31479735 GGAGTTTGCCTGGTGGACAGAGG + Intronic
1151133859 17:71925859-71925881 AAAGTTTATCTGGTGGGCAGGGG + Intergenic
1153789741 18:8567405-8567427 AGACGATGTCTAGTGCTCAGAGG + Intergenic
1154016259 18:10620557-10620579 AGTGCTTGTGCAGTGGTCAGAGG - Intergenic
1154189256 18:12215093-12215115 AGAGCTTGTGCAGTGGTCAGAGG + Intergenic
1157374290 18:47149466-47149488 AGACTTTATCCAGAGGTCAGCGG - Intronic
1157820238 18:50761986-50762008 AGAGGTTGAATAGTGGTTAGTGG - Intergenic
1159409352 18:68051348-68051370 AGAATTTGTATAGTGTTCAGTGG - Intergenic
1159796172 18:72846891-72846913 AGAATTTGTGGAATGGTCAGTGG - Intronic
1160318632 18:77869934-77869956 AGAGTTAGTCTAGTTCTTAGCGG - Intergenic
1161280674 19:3443933-3443955 AGAGTGTGTGGAGTGGACAGAGG - Intronic
926562468 2:14433354-14433376 AGAGTTTTTGTTGTAGTCAGGGG + Intergenic
928739950 2:34339657-34339679 AAAATTTGTCTAGAGGTCGGTGG - Intergenic
928945630 2:36769485-36769507 AGCGTTTGTCTAGCAGTCTGTGG - Intronic
929300080 2:40293463-40293485 AGAGTTTGTATACTAGTCACTGG + Intronic
929732065 2:44505691-44505713 GGAGTTTGTCTTGCTGTCAGAGG + Intronic
933487449 2:82940731-82940753 AGAGTTTCTATATTGGACAGGGG - Intergenic
936346608 2:111680286-111680308 AGTGGTTGTCTACTGGCCAGAGG - Intergenic
938086376 2:128404873-128404895 AGAGTTTGTCTAGGACTGAGGGG - Intergenic
939128730 2:138207765-138207787 AGGGTGGGTCTAGTGGTCATGGG + Intergenic
940890985 2:159035034-159035056 AGCCTTTGTCTTGTGGTCTGAGG + Intronic
943048183 2:182883498-182883520 AGACTTTTTCTAGTGGGCACTGG - Intergenic
946346061 2:219111472-219111494 AGATTTTTTCTAGGGGTCAGGGG - Intronic
1170703985 20:18728273-18728295 TGAGTTTGGCTTCTGGTCAGTGG + Intronic
1174574582 20:51527373-51527395 TGAGCTAGTCAAGTGGTCAGGGG - Intronic
1179585470 21:42371393-42371415 AGAGTGTGAGTGGTGGTCAGAGG - Intergenic
1180704047 22:17797923-17797945 GGAGCCTGTCTAGTGGGCAGAGG - Intronic
1181344463 22:22208151-22208173 AGTGTGAGTCTAGTGCTCAGTGG - Intergenic
949355699 3:3178590-3178612 AGAGGTTGTTTAAGGGTCAGAGG - Intronic
951699605 3:25482058-25482080 AGAGGTAGTCTAGTGGTTGGGGG - Intronic
954200405 3:49020568-49020590 AAAGTATGTCTGGGGGTCAGGGG + Intronic
954235577 3:49254737-49254759 AGATTTTGTTCAGTGGCCAGTGG + Intronic
954333057 3:49901068-49901090 CCAGCTTGCCTAGTGGTCAGTGG - Intronic
956531010 3:70218587-70218609 AGAGTTTCTATAGTGGTAACAGG + Intergenic
959021478 3:101192040-101192062 AGACTATGTGTTGTGGTCAGTGG - Intergenic
959131206 3:102358358-102358380 AGAGTATGTCTATTGTTCAGAGG - Intronic
959902537 3:111676319-111676341 GGAGTTTGTCTGGTAGTCTGTGG - Intronic
960203242 3:114863609-114863631 AGAATTTGTTTAGTGGACAGAGG - Intronic
960995717 3:123338937-123338959 TGAGTTTTTCTAGTGGTCTAGGG + Intronic
963384959 3:144581038-144581060 AGGTTTTGTGAAGTGGTCAGTGG + Intergenic
967094594 3:186166716-186166738 AGAGTATGTCTAGGGGTGAGGGG + Intronic
969171066 4:5364097-5364119 AGACTTTGTCCTGTGGACAGTGG - Intronic
970583332 4:17493005-17493027 AGAATTTATTTAGTGGTAAGTGG - Intronic
976270180 4:83222508-83222530 GGAGTGTCTCTAGTTGTCAGGGG - Intergenic
980876165 4:138664460-138664482 AGAGTTTGTCTTGGGATAAGTGG - Intergenic
981518576 4:145636458-145636480 AAATTTTGTCTTGTGGGCAGTGG - Intronic
982641528 4:157967856-157967878 AGAGTTTGTCTTTTTGTAAGGGG - Intergenic
986039156 5:3970475-3970497 AGAGATAGTATAGTGATCAGTGG + Intergenic
986353768 5:6904290-6904312 ACAGTTAGCCTAGTGGGCAGCGG + Intergenic
990148672 5:52790975-52790997 AGAGTTTATTTAGATGTCAGAGG - Intronic
994241345 5:97424977-97424999 GGAGTTTTTGTGGTGGTCAGAGG + Intergenic
995881810 5:116851703-116851725 AGTGTTTGTCTAGGGGAAAGAGG + Intergenic
997718380 5:136058899-136058921 ACAATCTGTCTAATGGTCAGAGG - Intronic
998500852 5:142631343-142631365 AGTGTTTTTCAAGTGGTTAGTGG - Intronic
999269505 5:150288654-150288676 AGAGTTTGCCTTGTGGGCAAAGG - Intronic
999643966 5:153700037-153700059 AGAGTTTGTCTAGCCCTCAGTGG + Intronic
1000641587 5:163709320-163709342 AGAGTTTGTCGAAAGGTCTGTGG - Intergenic
1001327301 5:170738421-170738443 AGAGTTTATCTAATAATCAGAGG + Intergenic
1001949369 5:175805619-175805641 TGGGTGGGTCTAGTGGTCAGGGG + Intronic
1002320762 5:178374298-178374320 AGAGTTTGTGCAGTGGAGAGAGG - Intronic
1005106642 6:22230789-22230811 AGAATTTGTTTAGTGGCAAGTGG - Intergenic
1006530343 6:34646982-34647004 AGGGTTAGACTATTGGTCAGAGG - Intronic
1007017042 6:38479274-38479296 AGGGTTTGGCCAGTGCTCAGTGG - Intronic
1008033988 6:46727021-46727043 ATATTTTATCTAGTGGTCAAGGG - Intronic
1009294458 6:61928020-61928042 AGTATTTTTCTGGTGGTCAGAGG + Intronic
1010401924 6:75455705-75455727 AAAGTTTTTCTGGTGGGCAGTGG - Intronic
1013922826 6:115429484-115429506 AGTGGTTGACTAGTGTTCAGGGG + Intergenic
1017610636 6:156182760-156182782 ATTGTTTGTATAGTGATCAGAGG + Intergenic
1018389680 6:163332490-163332512 AGAGTTGGATTAGTGGCCAGGGG - Intergenic
1019323492 7:426127-426149 AGAGTTTGTCTCCTCCTCAGCGG - Intergenic
1020924583 7:14309738-14309760 AGTATTTGTCTGGTTGTCAGAGG - Intronic
1028781398 7:94741180-94741202 AGTGTTTGTCTTTTGGTCACTGG - Intergenic
1035013368 7:155740827-155740849 ACAATGTGGCTAGTGGTCAGTGG + Intronic
1035561533 8:607935-607957 AAAGTTTGTCTGGTGCTCTGGGG - Intergenic
1043505507 8:80898094-80898116 AGAGATTGTCTGGTTTTCAGGGG - Intergenic
1046140434 8:110083633-110083655 AGGGTTTTTATAGTGTTCAGAGG - Intergenic
1050686105 9:8171078-8171100 AGAATTTATCTAGTGGGCAGAGG - Intergenic
1051334302 9:16052751-16052773 AGAGTTTGTGGAGTGAACAGAGG - Intronic
1052998600 9:34565116-34565138 AGAGTTTGCATAGTGCTGAGAGG + Intronic
1053141253 9:35684279-35684301 AGAGTTTGCCGAGAGGTCTGTGG - Exonic
1056823234 9:89859310-89859332 GGAGTTAGCCTAGAGGTCAGTGG + Intergenic
1058163037 9:101591009-101591031 AAAGAGTGTCTAGTGGTCTGGGG + Intronic
1060857491 9:126926616-126926638 AGGTGTTGTCTTGTGGTCAGTGG + Intronic
1061039722 9:128132973-128132995 GGAGTTAGCCTAGAGGTCAGTGG - Intergenic
1061423521 9:130485045-130485067 AGAGAATGTCTGGTGGGCAGAGG - Intronic
1190708864 X:53051035-53051057 AGAGTTTGGCCTGTGGTCAGTGG + Intronic
1191978428 X:66899417-66899439 AGAGCTTGTCTGGGGGGCAGTGG + Intergenic
1195903128 X:109818970-109818992 ACAGTTTGGCTAGAGGTAAGGGG - Intergenic
1196899353 X:120367875-120367897 AGAGTTTGTGGGATGGTCAGGGG - Intronic
1197405363 X:126041694-126041716 AGAATTTTTCCAGTGGTTAGGGG - Intergenic
1197504528 X:127285250-127285272 AGAGTAGGTCTAGTGGTAATAGG + Intergenic
1197708935 X:129652820-129652842 AGTGGTTGTCTATTGGCCAGGGG + Intronic
1198092189 X:133342401-133342423 AGATTTTGTCTAATGGTGAAAGG + Intronic
1198775917 X:140178795-140178817 AGACTATGTCTATTGGGCAGGGG - Intergenic
1201906537 Y:19091485-19091507 ACACTTTCTCTAGAGGTCAGAGG + Intergenic