ID: 922560717

View in Genome Browser
Species Human (GRCh38)
Location 1:226567607-226567629
Sequence CTATACAAAGAGATCGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922560712_922560717 6 Left 922560712 1:226567578-226567600 CCAGTAAACTTTATTTCCCAGAG 0: 1
1: 0
2: 0
3: 16
4: 255
Right 922560717 1:226567607-226567629 CTATACAAAGAGATCGAGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 67
922560713_922560717 -10 Left 922560713 1:226567594-226567616 CCCAGAGAATGAGCTATACAAAG 0: 1
1: 0
2: 2
3: 20
4: 193
Right 922560717 1:226567607-226567629 CTATACAAAGAGATCGAGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922560717 Original CRISPR CTATACAAAGAGATCGAGGG AGG Intronic
906868709 1:49452070-49452092 GTATACAATTAGATAGAGGGAGG - Intronic
909101562 1:71355668-71355690 AGATACAAAAAGATAGAGGGAGG - Intergenic
919429890 1:197479456-197479478 CTATCAAAAGAGATGGAGAGGGG - Intergenic
920087130 1:203425664-203425686 CTATACAAAGAGAGGGGAGGGGG + Intergenic
922560717 1:226567607-226567629 CTATACAAAGAGATCGAGGGAGG + Intronic
923093029 1:230753853-230753875 CTAAACAAAGGGAGGGAGGGAGG - Intronic
923294999 1:232585646-232585668 CCATACAAAGAGAACAAAGGAGG + Intergenic
1063599501 10:7467364-7467386 CTAATCAAAGAGGCCGAGGGAGG + Intergenic
1071913186 10:90258850-90258872 CTACCCAAAGACATTGAGGGTGG + Intergenic
1082921479 11:58499443-58499465 CTATACAGAGAGATTCATGGAGG - Intergenic
1083455161 11:62773862-62773884 CTAGACAAAGGGATTGGGGGTGG + Intronic
1086157998 11:83689289-83689311 ATATGCAAAGAGATGGTGGGGGG + Intronic
1092317939 12:7439774-7439796 CTGGACATAAAGATCGAGGGGGG - Intronic
1103684893 12:122724113-122724135 CTATAAAATGACATAGAGGGAGG - Intergenic
1109994770 13:70108515-70108537 CTATACGGAGAGATGGAGGGAGG + Intergenic
1120932916 14:89866633-89866655 CTAGACAAGGAGATCAAGGCTGG - Intronic
1124807788 15:32903918-32903940 CCATACGAAGAGTTGGAGGGGGG + Intronic
1128931008 15:71704988-71705010 CTATATGAAGTGATCAAGGGTGG + Intronic
1130877775 15:88029137-88029159 CTATACAAAAATAATGAGGGGGG + Intronic
1131583457 15:93667998-93668020 ATATACACAGAGAGAGAGGGAGG + Intergenic
1136869976 16:33798079-33798101 CTATATAACAAGATCTAGGGTGG - Intergenic
1137083546 16:36095781-36095803 CAAAATAAAGAGATGGAGGGAGG - Intergenic
1140829977 16:78742012-78742034 CTATACATAGACATCGTAGGGGG - Intronic
1203102195 16_KI270728v1_random:1317975-1317997 CTATATAACAAGATCTAGGGTGG + Intergenic
1142835189 17:2580345-2580367 CTATACAAAGTGAACAAGGGAGG + Intergenic
926154112 2:10441724-10441746 CTATATAAAGAGACGGAGAGAGG + Intronic
926390884 2:12391427-12391449 CTATAAAAAGAGAGTGAGGAGGG - Intergenic
929283660 2:40111317-40111339 CTATATAAAGAAATAGAGGTTGG + Intronic
932614532 2:73223511-73223533 CTATACAAGGACATCGAGGCAGG + Exonic
935822334 2:106906677-106906699 CTATATAAAGAGATTAAGCGTGG - Intergenic
941470363 2:165878077-165878099 TTATACTAAGAGTTAGAGGGAGG - Intronic
941720136 2:168803929-168803951 CTATACAAAAACATTGAGGTAGG - Intronic
942747247 2:179248519-179248541 TTATACAAAGTAATCAAGGGGGG + Intronic
943866822 2:192935666-192935688 CTATACAAAGAGATAAAGAAGGG - Intergenic
944540844 2:200752090-200752112 CCAAACAAAGAGATGGAGGAAGG - Intergenic
1170323189 20:15124777-15124799 CAATACAAAGAAAGCCAGGGAGG - Intronic
950888119 3:16378420-16378442 CTAAACAAAGAGTTTGAAGGAGG + Intronic
951988938 3:28653959-28653981 CTTTACAAAGAAATAGAGGAAGG - Intergenic
953861062 3:46544506-46544528 AGATACAAAGAGATGGACGGAGG + Intronic
957741587 3:84277736-84277758 ATATACAGAGAGAGAGAGGGTGG + Intergenic
958001195 3:87750934-87750956 ATATACAAAAAGATCAATGGAGG - Intergenic
958156392 3:89761319-89761341 CTCTACACAGGGATTGAGGGTGG + Intergenic
959334914 3:105052046-105052068 CTAGAAAAAGAGAGAGAGGGAGG + Intergenic
965694231 3:171390425-171390447 CCTTAAAAAGAGATCGAAGGTGG - Intronic
966448223 3:180027481-180027503 ATATACATAGAGAGAGAGGGAGG - Intronic
967707418 3:192667645-192667667 CTATGCAAAGAGACGGAGTGAGG + Intronic
972462504 4:39317858-39317880 CTATACAAAGAAATGGCGGCCGG + Intronic
975621424 4:76300383-76300405 ATAAACAAAGAGGTCCAGGGTGG - Intronic
982794776 4:159631345-159631367 CTAAACAAAGAGATAGAGGTAGG + Intergenic
984922421 4:184777471-184777493 ATGTACAAAGAGAGGGAGGGAGG + Intronic
990014871 5:51047665-51047687 CTTTACAAAGAAATCAAGGGAGG - Intergenic
993556458 5:89345560-89345582 CTATACACAGAGAACTAGGGAGG + Intergenic
997843696 5:137266144-137266166 TGATACGAAGAAATCGAGGGAGG - Intronic
999006302 5:147983678-147983700 CTAGTCAAAGAGATGTAGGGTGG - Intergenic
999095972 5:148978584-148978606 CTATGGAAAGAGCTGGAGGGAGG - Intronic
1004229591 6:13819357-13819379 CTGTACAAAGAGATATAGGTTGG + Intergenic
1008806499 6:55435732-55435754 CTATACAAAGTGATGGAAGCTGG - Exonic
1016753227 6:147654388-147654410 CTATACAAAGAGCTCCGTGGGGG + Intronic
1023711158 7:42994368-42994390 CTATATTAAGAGATGGAGGGAGG - Intergenic
1025800108 7:64778869-64778891 CTATACAAAAATATAGAGTGGGG - Intergenic
1027141466 7:75660849-75660871 ATAAACAAAGAGATGGAGAGAGG - Intronic
1037241199 8:16780297-16780319 CAATGCAAAGAGATGCAGGGTGG - Intergenic
1037827748 8:22169324-22169346 TGAGACAAAGAGAGCGAGGGAGG - Intronic
1039224915 8:35377986-35378008 TTATACAAAGAGTTAGGGGGAGG - Intronic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1042074667 8:64978747-64978769 CCATAGAAAGAGATCGAGGTTGG + Intergenic
1050530694 9:6586469-6586491 CTTTACAAAGAAATTGAGGCTGG + Intronic
1051776283 9:20637651-20637673 CTATAAAAAGACATAGAGAGAGG + Intergenic
1059342492 9:113605950-113605972 CTATAAAAGGGTATCGAGGGAGG - Intergenic
1188838346 X:34986024-34986046 GTATACAAAGTGATCTAGGGTGG + Intergenic
1193086130 X:77448862-77448884 CTATACTAAGACATCATGGGGGG + Intronic
1195292965 X:103446877-103446899 CACTACACAGAGACCGAGGGAGG - Intergenic
1195885326 X:109631310-109631332 ATAGACAAATAGATAGAGGGAGG - Intronic
1196492943 X:116290093-116290115 CTATACAAGGACACCTAGGGTGG - Intergenic
1198431677 X:136573705-136573727 CTATATATAGAGAGGGAGGGAGG + Intergenic
1199159490 X:144591628-144591650 CTATGCAAAGAGATCAAAGTTGG + Intergenic
1201395690 Y:13545307-13545329 CTATACAAAAAGAGCAAAGGTGG + Intergenic