ID: 922564055

View in Genome Browser
Species Human (GRCh38)
Location 1:226589753-226589775
Sequence GGTCCTCTGCAGCAGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 6, 3: 44, 4: 320}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922564055_922564066 10 Left 922564055 1:226589753-226589775 CCCTGTCCCTGCTGCAGAGGACC 0: 1
1: 0
2: 6
3: 44
4: 320
Right 922564066 1:226589786-226589808 TCCAGCCCTGAGTCATGTGGGGG 0: 1
1: 0
2: 3
3: 20
4: 201
922564055_922564063 7 Left 922564055 1:226589753-226589775 CCCTGTCCCTGCTGCAGAGGACC 0: 1
1: 0
2: 6
3: 44
4: 320
Right 922564063 1:226589783-226589805 CGCTCCAGCCCTGAGTCATGTGG 0: 1
1: 0
2: 1
3: 13
4: 145
922564055_922564070 20 Left 922564055 1:226589753-226589775 CCCTGTCCCTGCTGCAGAGGACC 0: 1
1: 0
2: 6
3: 44
4: 320
Right 922564070 1:226589796-226589818 AGTCATGTGGGGGAAGCCGTTGG 0: 1
1: 0
2: 0
3: 6
4: 116
922564055_922564065 9 Left 922564055 1:226589753-226589775 CCCTGTCCCTGCTGCAGAGGACC 0: 1
1: 0
2: 6
3: 44
4: 320
Right 922564065 1:226589785-226589807 CTCCAGCCCTGAGTCATGTGGGG 0: 1
1: 1
2: 3
3: 21
4: 191
922564055_922564064 8 Left 922564055 1:226589753-226589775 CCCTGTCCCTGCTGCAGAGGACC 0: 1
1: 0
2: 6
3: 44
4: 320
Right 922564064 1:226589784-226589806 GCTCCAGCCCTGAGTCATGTGGG 0: 1
1: 0
2: 2
3: 11
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922564055 Original CRISPR GGTCCTCTGCAGCAGGGACA GGG (reversed) Intronic
902808901 1:18877329-18877351 GCTCCTCTGCAGCCGGGGCTGGG - Intronic
903179283 1:21597341-21597363 GGTTCTCTGAGGCAGGGACTTGG - Intronic
903220513 1:21866665-21866687 GGTCCTCTGCAGCAGAAGTAAGG - Intronic
904266406 1:29320716-29320738 GGTGCTCTGCAGCGGGTGCAGGG - Exonic
904409572 1:30317346-30317368 GGCCCCCTGCAGGAGGGATATGG - Intergenic
904755596 1:32766882-32766904 GCTCCTCTGCAACAGGGGCCAGG + Intronic
904937824 1:34144321-34144343 GGTCCTCTGGAGCATGGACTGGG - Intronic
905242250 1:36588731-36588753 TGTCCCCAGGAGCAGGGACAGGG - Intergenic
907496875 1:54851297-54851319 GCTGCTCTGCAGCAGGGGCTGGG - Exonic
907770702 1:57460698-57460720 GGGCCTCTGTAGCTGTGACAAGG - Intronic
908239765 1:62178997-62179019 GGTCCTCTGTAAAAGGGAAAGGG - Intergenic
910220013 1:84880553-84880575 GGTCCTCTGCAGCATGGACTTGG - Intronic
910608435 1:89113089-89113111 GTTCCTCTGCTGCACAGACAAGG - Intronic
912675836 1:111679913-111679935 GGTGCTCTGTACCAGGGAGATGG - Intronic
913288952 1:117254241-117254263 GTTCCTCTGCCCCAAGGACATGG + Intergenic
915098196 1:153478941-153478963 GGTTCTCAGCAGAGGGGACATGG + Intergenic
915269970 1:154747002-154747024 GGACCTGGGCAGCAGGGAGAGGG - Intronic
915688489 1:157662171-157662193 GGTGCTCTGCCCCAGGGAGATGG - Intergenic
917507224 1:175638533-175638555 GGACCTCTGCACCAGGGCAAGGG + Intronic
920255165 1:204649782-204649804 GATTCTCTGCAGCCGGGAGAGGG - Intronic
922169440 1:223142752-223142774 GGCCATCTCCAGCAGGGCCATGG - Intronic
922564055 1:226589753-226589775 GGTCCTCTGCAGCAGGGACAGGG - Intronic
923565038 1:235070124-235070146 AGTCCCATGCAGCAGGGAGAAGG - Intergenic
1063280902 10:4628405-4628427 TGTCCTCTTCAGCAAGGTCATGG + Intergenic
1064699758 10:18006917-18006939 GGGTCTCTGCAGCAGTGACTGGG + Intronic
1065621646 10:27587843-27587865 GGTGCTCTGCCCCAGGGAGATGG - Intergenic
1065747637 10:28856838-28856860 CTTCCTCTGCAGCAGGGAGCTGG - Intronic
1065789168 10:29243921-29243943 GTTCACCTGCTGCAGGGACAAGG + Intergenic
1067832717 10:49619741-49619763 GGTCTGCTGCAGCGGGGGCACGG - Exonic
1070148217 10:73789754-73789776 GTCCCTCTGTAGCCGGGACAGGG - Exonic
1070598553 10:77849627-77849649 GGTCCTTGGCAGCAGGGGCGGGG - Intronic
1071450923 10:85790833-85790855 GGTCCTGTGCAGCCAGGACAAGG - Intronic
1071567703 10:86680282-86680304 GGTCAGCTGCAGCAGGGGCAGGG - Intronic
1071975819 10:90954918-90954940 GGTGCTCTGCCCCAGGGAGATGG + Intergenic
1072225097 10:93361402-93361424 GGGGCTCTGCAGCAGGGCCTTGG - Intronic
1073111788 10:101066938-101066960 GGTCCGCTGCAGCAGAGGCGGGG - Intronic
1074763886 10:116686661-116686683 GGGCCACGGCAGCAGGGACAGGG + Intronic
1074875105 10:117607577-117607599 GCTCCTGTGAAGCAGGGAGATGG - Intergenic
1075983875 10:126766662-126766684 GGTCCTCTGTCCCAGGGAGATGG + Intergenic
1076764507 10:132625615-132625637 GAGCCTCTGCTGCAGGGGCAAGG + Intronic
1076809977 10:132881420-132881442 CCTCCTTTCCAGCAGGGACATGG - Intronic
1077278044 11:1726392-1726414 GGTCTTCTCCATGAGGGACATGG + Intergenic
1077319470 11:1934814-1934836 CTTCCTCTGCCCCAGGGACAAGG + Exonic
1077460956 11:2709239-2709261 AGTCCTCTGCAGCTGGGGCTGGG - Intronic
1078003862 11:7517926-7517948 GGTCCTCCGCAGAGGGGGCACGG + Intronic
1078550021 11:12273789-12273811 TGTCCCCAGGAGCAGGGACAGGG + Intergenic
1079146619 11:17858024-17858046 TGTTCCCTGCAGCAGGCACAGGG - Intronic
1079175635 11:18137645-18137667 GATACTCCGCAGCAGGGACAGGG - Exonic
1079181390 11:18196811-18196833 GGTGTTCAGCAGCAGGGACAGGG - Intronic
1079256620 11:18836632-18836654 GATGCTCAGCACCAGGGACAGGG - Intergenic
1079259424 11:18864039-18864061 GATGCTCTGCAGCAGGGACAGGG + Intergenic
1079261571 11:18887435-18887457 GATGCTCTGCAACAGGGACAGGG + Intergenic
1079263826 11:18910933-18910955 GATGCTCTACAGCAGGGACAGGG + Intergenic
1079266064 11:18934320-18934342 GATGCTCCGCAGCAGGGACAGGG + Exonic
1079269647 11:18972236-18972258 GATGCTCCGCAGTAGGGACAGGG + Intergenic
1079277530 11:19055917-19055939 GATGCTCAGCAGTAGGGACAGGG + Exonic
1079696164 11:23484544-23484566 GGTCCTCTGTCCCAGGGAGATGG - Intergenic
1080368664 11:31608955-31608977 AGTCTTCAGCAGCAGGGCCAAGG + Intronic
1080874239 11:36261960-36261982 GAGCCTCTGCAGCAGGGATGGGG - Intergenic
1081118319 11:39232587-39232609 GGTGCTCTGTAGCAGGGAGATGG - Intergenic
1081375263 11:42351086-42351108 GGTTCTCTGCAGAAGGGATGAGG - Intergenic
1083631580 11:64098051-64098073 TGTCCTCAGGAACAGGGACAGGG - Intronic
1084153669 11:67302739-67302761 GGTCCCCAGCAGGTGGGACAGGG - Intergenic
1084297851 11:68224844-68224866 GCTCCTCAGCAGCAGGCACCCGG + Intergenic
1084613258 11:70217684-70217706 GGTCCTGTACAGATGGGACATGG + Intergenic
1084935642 11:72585185-72585207 GCTCCAATACAGCAGGGACAGGG - Intronic
1086133172 11:83421458-83421480 GGTCCTATACAGATGGGACATGG - Intergenic
1086201140 11:84203612-84203634 TATCCTTTGCAGCAGGGACATGG + Intronic
1087014337 11:93542049-93542071 GGTCATTTGCAGCAGTGATACGG - Intronic
1087049005 11:93867691-93867713 GGTCCTCCACAGAAGGGGCATGG + Intergenic
1087159722 11:94936756-94936778 GGGCCACTGCAGTAGGGTCAGGG + Intergenic
1087662374 11:101002529-101002551 GGCCCCCAGAAGCAGGGACAAGG - Intergenic
1091320002 11:134642694-134642716 TGTCTTCTGCATCAGGGAGATGG + Intergenic
1092131968 12:6119089-6119111 GGTCTTGTGCAGCAGGGAAGTGG - Intronic
1093358459 12:18197285-18197307 GGTCCTGTACAGATGGGACATGG - Intronic
1094101778 12:26772042-26772064 GGTCTTCTGCAGCTGTTACACGG - Intronic
1096512852 12:52141290-52141312 GGACCCCTGCTGCAGGGGCAAGG - Intergenic
1096587490 12:52632263-52632285 GCTCCTATGCAGCAGGGCAAGGG + Intergenic
1096620065 12:52858840-52858862 GGTTCACTGCAACAGGGAAAGGG + Intergenic
1098381982 12:69879279-69879301 GGTGCTCTGCAGCGGGTGCATGG - Intronic
1101323185 12:103691776-103691798 GGTCCTCTGCAGATGTGACTTGG + Intronic
1103447277 12:121002349-121002371 GGTTCTCAGCAGCAGGCCCAGGG - Exonic
1103510110 12:121467803-121467825 GGTCCCTTGCAGCAGGCACACGG + Intronic
1104393949 12:128415431-128415453 GATCCTCTGCAGGTGGGACGTGG - Exonic
1104716272 12:131018368-131018390 CGTCCTCCACAGCAGGGGCAAGG - Intronic
1109432420 13:62252776-62252798 TGTCCTTTGCAGCAGCAACATGG - Intergenic
1109826553 13:67728843-67728865 CTTCCTCTGCAGGTGGGACATGG - Intergenic
1111028515 13:82567015-82567037 GCACCTCTGCAGCAGGGTCAGGG - Intergenic
1114237290 14:20834229-20834251 GGTCCTCTGCAGAGGGGGCATGG + Intergenic
1115357206 14:32461085-32461107 GGTGCTCTGTCCCAGGGACATGG - Intronic
1115538090 14:34392042-34392064 GGTGCTCTGTCCCAGGGACATGG - Intronic
1115940295 14:38601433-38601455 GGTCCTCTGTCCCAGGGAGATGG + Intergenic
1118433860 14:65751251-65751273 GGTTCTCTGAAGCACAGACAGGG - Intergenic
1118941895 14:70346463-70346485 GGTCCTCTGCAGAGGGGGCATGG - Intronic
1119643898 14:76334879-76334901 GCTGGTCTGCAGCAGGGACAGGG + Intronic
1121637036 14:95460987-95461009 GGACCTCGGCAGGAGGGGCAGGG + Intronic
1121899033 14:97675153-97675175 GGTGCTCTGCCCCAGGGAGATGG - Intergenic
1122552418 14:102557148-102557170 TGTCCGCTGCAGCTGGGACATGG + Intergenic
1122891841 14:104735643-104735665 GTCCCTCTGCAGCACGGACTGGG - Intronic
1124236040 15:27990115-27990137 GGGCCTCTCTGGCAGGGACATGG - Intronic
1124399902 15:29338961-29338983 AGTCCTCTACATCAGGGACCAGG + Intronic
1124474634 15:30022506-30022528 GGTGCTCTGTACCAGGGAGATGG + Intergenic
1126806419 15:52353870-52353892 GGTGCTCCGCAGCAAGGCCAAGG - Exonic
1127139610 15:55961361-55961383 GGTCCTCTGCTACAGGGTCTTGG - Intronic
1128818469 15:70631092-70631114 TGCCCACTGCTGCAGGGACAGGG + Intergenic
1128837059 15:70817643-70817665 GCTCCACTGGTGCAGGGACAGGG - Intergenic
1129499110 15:76018945-76018967 GGTCCTCTGTTCCAGGGAGATGG + Intronic
1129563247 15:76593344-76593366 GGTGCTCTGCCCCAGGGAGATGG - Intronic
1129960824 15:79682371-79682393 TGTGCTCTGCAGCAGGGCCCTGG - Intergenic
1130261017 15:82354562-82354584 GGTCCTTTGCAGCTTGAACACGG + Intergenic
1130280218 15:82514456-82514478 GGTCCTTTGCAGCTTGAACACGG - Intergenic
1130471593 15:84230642-84230664 GGTCCTTTGCAGCTTGAACACGG - Intergenic
1130479087 15:84345213-84345235 GGTCCTTTGCAGCTTGAACACGG - Intergenic
1130492683 15:84442918-84442940 GGTCCTTTGCAGCTTGAACACGG + Intergenic
1130593889 15:85235270-85235292 GGTCCTTTGCAGCTTGAACACGG - Intergenic
1130603613 15:85295434-85295456 GCTGATCTGCAGCAGGGAGAGGG - Intergenic
1130613178 15:85380001-85380023 GGTCCTTTGCAGCTCGAACACGG + Intergenic
1130722960 15:86407966-86407988 ACTCCTCTGCAGGAGGGAGAAGG + Intronic
1130874673 15:88003312-88003334 GGTCCTTTCCAGCAGAGCCAAGG + Intronic
1131671374 15:94623219-94623241 GTTCCTCTGCTACAGGCACAAGG - Intergenic
1132892344 16:2210492-2210514 CCTCCTCAGCACCAGGGACATGG - Intronic
1132936144 16:2482377-2482399 GGACCTCTGGGGCAGGGCCAAGG - Intronic
1133033305 16:3021730-3021752 GGTCGTCAGCAGCAGAGAAAAGG - Intronic
1133040349 16:3057256-3057278 TGTCCTCTGCAGCAGGGCCAGGG + Intronic
1134079719 16:11316433-11316455 GGCCCTGTGAGGCAGGGACAGGG - Intronic
1137933768 16:52613761-52613783 GAATCTCTGCAGCAGGGGCAGGG - Intergenic
1138534026 16:57650295-57650317 TGTCGTCTGCAGCAGCGACTGGG - Exonic
1139321251 16:66116214-66116236 TGTCCTCTGCAGCAGTGCCTTGG - Intergenic
1139548550 16:67661037-67661059 AGTCCTCTGCGGCCGGGCCATGG - Exonic
1140040394 16:71403735-71403757 GGACAACTGCAGCAGGGCCAAGG - Intergenic
1140714726 16:77712127-77712149 GGTCCTCCCCAGCAGCTACAGGG + Intergenic
1140835732 16:78792059-78792081 GCTCCCCCGCACCAGGGACAGGG - Intronic
1141592348 16:85077316-85077338 GGTCCTGTGCAGTGGGGATACGG - Intronic
1142285432 16:89169723-89169745 GGTCCTGTGCAGTGGGGGCAGGG - Intergenic
1143009660 17:3858995-3859017 GGTCTGCTGCAGAAGGGATATGG + Intergenic
1143611438 17:8020143-8020165 GGTCCACTGCAGATGGGACAGGG - Exonic
1143616817 17:8056501-8056523 AGTCCTCTGCAGTAGGGTTAAGG + Intergenic
1145243434 17:21252804-21252826 GGTCCCCTGCGGCTGAGACAGGG + Intronic
1148795471 17:50194783-50194805 CTTCCTCTCCAGCAGGGCCAGGG + Exonic
1148967428 17:51447511-51447533 GGTGCTCTGCCCCAGGGAGATGG - Intergenic
1150470265 17:65431290-65431312 CCTCCTCTGCAGCAGGGGCATGG + Intergenic
1151309739 17:73285819-73285841 CGTCCTCAGCATCATGGACAAGG - Exonic
1151623741 17:75263378-75263400 GTTCCTCTGCAGAAGCGGCATGG - Exonic
1152625096 17:81384376-81384398 GGGCCTGTGGGGCAGGGACAGGG + Intergenic
1152650350 17:81489640-81489662 GGTCCGCAGCAGCAGGGAAGGGG - Intergenic
1152699977 17:81813864-81813886 TCACCTCTGCACCAGGGACAAGG - Exonic
1153112886 18:1614334-1614356 TGTACTCTGCTGCAGGGACCAGG - Intergenic
1153332689 18:3890022-3890044 GGTCATCTGCAGCAGAACCAAGG + Intronic
1155157352 18:23168767-23168789 GGGCCTCATCAGCAGGGACATGG - Intronic
1156915831 18:42463905-42463927 GGTCCTGTGCAGATGGGACACGG - Intergenic
1157727272 18:49974478-49974500 GATCACCTGCTGCAGGGACATGG + Exonic
1157865737 18:51182724-51182746 GGTCCTCTGCCGCTGGGAAAGGG + Intronic
1158509984 18:58081733-58081755 AGTGCTCCGAAGCAGGGACAAGG - Intronic
1158812401 18:61052929-61052951 TGTCCTTTGCAGCAGCAACATGG + Intergenic
1160153521 18:76413356-76413378 GCTCCTAGGCAGCAGGGAGAGGG + Intronic
1160168274 18:76532021-76532043 GGTCCTGGGCAGCTGGGTCATGG + Intergenic
1160389386 18:78518635-78518657 GCACCTCTGGAGGAGGGACATGG + Intergenic
1160833238 19:1112944-1112966 GGTCATCTGCAGCCGAGACAGGG + Exonic
1161017291 19:1989597-1989619 GGTCCCCTGCTGCAGGGCCTGGG - Intronic
1163688173 19:18724142-18724164 GCTCCTCGGCAGCATCGACACGG + Intronic
1163723783 19:18911066-18911088 CTTCCTCTGCAGTAGGGACGAGG + Exonic
1164905884 19:31967699-31967721 GGAACTCTGCAGCAGGGTTAGGG - Intergenic
1165176494 19:33934289-33934311 GAAGCTCTGGAGCAGGGACAAGG + Intergenic
1165223823 19:34339890-34339912 GCTTCTCTGCAGCAGGGACATGG - Exonic
1165721493 19:38082432-38082454 GGGCCTCGGCGGCGGGGACACGG + Exonic
1166544674 19:43626913-43626935 GGGCCACTGCCGCAGGGAGAAGG + Exonic
1166674660 19:44732622-44732644 GGTCCTCTGCGGCAGGATCCTGG + Intergenic
924972409 2:140973-140995 GTTCCTCTGCAGCAGTAACGGGG - Intergenic
924994211 2:341860-341882 GGCCCACTGCAGGGGGGACACGG + Intergenic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925893559 2:8455173-8455195 GGGCCACTGCAGCAGGAAGAGGG + Intergenic
926203434 2:10817728-10817750 GGGCCACTGGAGCAGTGACAGGG + Intronic
932405590 2:71511025-71511047 GGACCTGTGGAGCCGGGACAGGG + Intronic
934660763 2:96142587-96142609 GGTCCTCTGCACCAGACACAGGG + Intergenic
934845754 2:97660513-97660535 GGTCCTCAGTTGCAGGAACATGG - Intronic
935403534 2:102684932-102684954 TAAGCTCTGCAGCAGGGACAGGG - Intronic
937635449 2:124150890-124150912 GCTACTCTTCAGAAGGGACAGGG - Intronic
938197315 2:129339964-129339986 GATCTTCTGCAGCAGGGAGCTGG - Intergenic
940193877 2:151071641-151071663 GGTCTTCTCCAGCAGGCTCATGG - Intergenic
941740263 2:169028351-169028373 GCTCCTCTGCATCAGGGCCCAGG - Intronic
944080928 2:195787763-195787785 TGTCCCCTGCAGCTGGGGCAGGG + Intronic
946441956 2:219704240-219704262 TGTCCTGGGCAGAAGGGACAAGG + Intergenic
946790188 2:223293250-223293272 GGTGCTCTGCCCCAGGGAGATGG + Intergenic
947238575 2:227969956-227969978 GGTCATCAGCTGCAGGGATAAGG + Intergenic
947395604 2:229683860-229683882 GGGGCTGTACAGCAGGGACAAGG + Intronic
948166364 2:235865653-235865675 GGTGCTCTGGAGGAGGGGCAGGG + Intronic
948373631 2:237505895-237505917 GGTCCCCTGCCCCAAGGACAAGG + Intronic
948398390 2:237664066-237664088 GTCTCTCTGCAGCATGGACATGG - Intronic
948449473 2:238060517-238060539 GGGCCGCGGCAGCAGGGCCAGGG - Intronic
948609039 2:239155265-239155287 GGTCCACTCCACCTGGGACATGG + Intronic
1168757837 20:328214-328236 GGGCCACAGCAACAGGGACAGGG - Exonic
1169320010 20:4624940-4624962 GGTGCTCTGCCCCAGGGAGATGG + Intergenic
1169563679 20:6829246-6829268 TTTCCTCTACATCAGGGACAGGG + Intergenic
1170708426 20:18767117-18767139 AGTCCCCTGCAGCAGAGAGACGG + Intergenic
1170897359 20:20427634-20427656 GGGCCACTGCAGCAGGTGCATGG - Intronic
1171292446 20:23990073-23990095 GGACCTCTGCAGCAGGTGCTAGG - Intergenic
1171350734 20:24501313-24501335 TATCCTCTGCAGCATGCACAGGG + Intronic
1172070269 20:32251646-32251668 TGTCTTCAGCAGCAGAGACAGGG + Intergenic
1172254871 20:33508733-33508755 TGTCCTTTGCAGCAGGGACATGG - Intronic
1173151489 20:40570017-40570039 TGTCCTTTGCAGCAGCAACAGGG + Intergenic
1173794361 20:45848670-45848692 GGTCCCCTGCAGTGGGCACAAGG + Exonic
1174471813 20:50767116-50767138 GGCCTTCTTCAGCAGGGAGATGG + Intergenic
1175301367 20:57945633-57945655 GTTACCCTGCAGGAGGGACAAGG - Intergenic
1176103801 20:63376418-63376440 CTTCCTCTGCAGCAGGGACTGGG - Intronic
1176290726 21:5043267-5043289 GGTCCTGAGCCGCAGGGACATGG + Intergenic
1176334693 21:5585042-5585064 GGTCCTCTTTTGCAGGGTCAAGG + Intergenic
1176393064 21:6235906-6235928 GGTCCTCTTTTGCAGGGTCAAGG - Intergenic
1176468355 21:7080268-7080290 GGTCCTCTTTTGCAGGGTCAAGG + Intronic
1176491916 21:7462046-7462068 GGTCCTCTTTTGCAGGGTCAAGG + Intergenic
1176508726 21:7676337-7676359 GGTCCTCTTTTGCAGGGTCAAGG - Intergenic
1177042662 21:16132810-16132832 GGTGCTCTGCCCCAGGGAGATGG + Intergenic
1177439061 21:21095866-21095888 GTTCCTCTGCATCAGGTACTGGG - Intronic
1178356032 21:31911458-31911480 GTTCCTCAGCAGCAGAAACAGGG - Intronic
1178576276 21:33794842-33794864 GGGCTTCTCCAGCAGGGTCAGGG + Intronic
1179483763 21:41695631-41695653 GGTCCTCATCAGCAGAGCCAGGG - Intergenic
1179667553 21:42923123-42923145 GGTCCTCTGCAGAGGGGGCACGG + Intergenic
1179866529 21:44220374-44220396 GGTCCTGAGCCGCAGGGACATGG - Intergenic
1179983951 21:44910886-44910908 CACCCCCTGCAGCAGGGACAGGG - Intronic
1182547264 22:31083454-31083476 GGGCCTCTGCATCAGCCACATGG - Intronic
1183463506 22:37967394-37967416 GGCCTCCTGCAGCAGGAACAGGG - Intronic
1183930242 22:41231866-41231888 GCCCCTCTGCTGCAGGGAAAGGG + Intronic
1184031923 22:41900313-41900335 GGGCTCCTGCAGCAGTGACAGGG - Exonic
1184288642 22:43486485-43486507 GGGCCACTGCAGCAGCCACATGG + Intronic
1184608767 22:45589549-45589571 GGCCCCCTGCTGCAGGGCCATGG - Intronic
1184901425 22:47448764-47448786 GGTGCCCTGCAGCAGCCACAGGG - Intergenic
1184951330 22:47844521-47844543 CCTCCTGTGCAGGAGGGACAGGG + Intergenic
1185075578 22:48680394-48680416 GGGCCCCGGCAGCAGGGACTGGG - Intronic
950020205 3:9781757-9781779 GCTGCTCTGCAGCAGGGTAAGGG + Intronic
950110312 3:10414501-10414523 TGTCCTCTTCAGAAGGGCCAAGG - Intronic
950478674 3:13230855-13230877 GGTCCTCTTCAACTGGGGCATGG + Intergenic
950561945 3:13736002-13736024 GGTGCTCTGTCTCAGGGACATGG + Intergenic
951195950 3:19823474-19823496 AGTCCTCTGCAGCAGTGGCTAGG + Intergenic
951504248 3:23424589-23424611 GGTCCTCTGCTCCAGGCATAAGG + Intronic
954683758 3:52359611-52359633 GGTACTGTGCAGGAGGGACCAGG - Intronic
960165262 3:114394358-114394380 GTTCCAATGCAGCATGGACACGG + Intronic
960763274 3:121096961-121096983 GGTGCTCTGTCCCAGGGACATGG + Intronic
960935056 3:122894244-122894266 GGGCCTCTGCAGCAGCCACATGG - Intergenic
961558240 3:127711287-127711309 GGTCCTCTGGGGGAGGGTCAAGG - Intronic
961649970 3:128412444-128412466 TGTCCTCTGAGGCAGGGACTGGG + Intergenic
961666775 3:128497665-128497687 GAGCCTCTGCAGCTGGGACAAGG + Intergenic
962124871 3:132606653-132606675 GGTCCTCTGTCCCAGGGAGATGG - Intronic
962256301 3:133872360-133872382 GGCCCTGTGCAGCAGGGATGCGG - Intronic
964940938 3:162157513-162157535 GGTCCTGTACAGATGGGACATGG + Intergenic
970793798 4:19889634-19889656 GGTCCTCCGCAGAGGGGTCATGG - Intergenic
971137577 4:23886496-23886518 GATCCCTGGCAGCAGGGACAAGG + Intronic
973781290 4:54290510-54290532 GGTCCTCCTCCTCAGGGACAGGG - Exonic
974491591 4:62571543-62571565 GGTGCTCTGTCCCAGGGACATGG + Intergenic
975229177 4:71910759-71910781 TGTCCTATGCAGCAGGAGCAGGG + Intergenic
975731571 4:77342695-77342717 GGGCCTCTGAACCAAGGACAAGG + Intronic
976300047 4:83508367-83508389 GGTCCTCTGCAGAGGGGGCACGG + Intronic
980494137 4:133569939-133569961 GGTGCTCTGTCTCAGGGACATGG + Intergenic
981469046 4:145108664-145108686 GGCCTACTGCAGCAGGGAGAAGG + Intronic
981888829 4:149712811-149712833 AGTCCTCTACTCCAGGGACATGG - Intergenic
982202472 4:152973891-152973913 GGTTCTCTGGAGCAGGGTGAAGG + Intronic
982268757 4:153565176-153565198 GAAGCTCTGCAGGAGGGACAGGG + Intronic
982436864 4:155389960-155389982 GGTCCACTGGAGGAGGGAGATGG + Intergenic
982584526 4:157220822-157220844 GGACTTCTGGAGCGGGGACAGGG + Exonic
982825768 4:160002176-160002198 GGTGCTCTGTACCAGGGAGACGG - Intergenic
983596277 4:169471742-169471764 GGTGCTCTGTCCCAGGGACATGG + Intronic
984947623 4:184982464-184982486 GGAGCTCTGGAGCAGGGGCAGGG - Intergenic
985511360 5:315897-315919 GGTCATCTGCTGCAGAGTCATGG - Intronic
985591713 5:768925-768947 CCTCCTCTGCAACACGGACATGG + Intergenic
985609629 5:879884-879906 CCTCCTCTGCAACACGGACATGG + Exonic
986113635 5:4747923-4747945 TGCCCACTGCAGCAGGAACAGGG + Intergenic
986169995 5:5307425-5307447 GGGCCTCTGCAGCAGGCAGAGGG - Intronic
986378789 5:7162420-7162442 GGTCCTCTGTCCCAGGGAGATGG + Intergenic
986669309 5:10128515-10128537 AGTCCTCTGCATCAGAGTCACGG - Intergenic
987546553 5:19317583-19317605 TGTCCTTTGCAGCAGGGACATGG - Intergenic
988627986 5:32898483-32898505 GGTGCTCTGTCGCAGGGAGATGG + Intergenic
989585813 5:43073171-43073193 GGTCCTCTGCAGAGGGGGCATGG + Intronic
989688884 5:44118112-44118134 GGTCCTGCACAGCTGGGACATGG + Intergenic
992406981 5:76468771-76468793 GGTCCTGTGCAGGAGGGAACAGG - Intronic
993365511 5:87030080-87030102 GGTCCTCTGACCCAGGGAGATGG + Intergenic
995108241 5:108399301-108399323 GGTGCTCTGTCGCAGGGAGATGG - Intergenic
995152366 5:108863988-108864010 GTTTCTCTTCAGCAGTGACAGGG + Intronic
999140374 5:149357761-149357783 GGTCCTCAGCATCAGGACCAGGG - Intergenic
999331718 5:150677989-150678011 GGTGTTCTGCAGAAGGGAGAAGG + Exonic
999688353 5:154122679-154122701 GGTGCTCTGCCCCAGGGAGATGG - Intronic
1000442934 5:161284615-161284637 TGTCCTCTGCAGCAGAGATATGG + Intergenic
1000635696 5:163641381-163641403 AGTTCTCAGCAGTAGGGACATGG + Intergenic
1002578852 5:180195047-180195069 TGTTCTCTGCAGCAGGCACTGGG - Intronic
1002831652 6:827229-827251 GGGCCACTGCAGCAGGGAAGGGG - Intergenic
1003133096 6:3412562-3412584 AGTCCTCTGCATTACGGACAAGG - Intronic
1003614347 6:7641744-7641766 GGTCCCCTGCAGCTGGCACATGG + Intergenic
1003713468 6:8619429-8619451 GGTCCTCTGTCTCAGGGAGATGG + Intergenic
1005549235 6:26897564-26897586 GGACCTCTGCAGCAGATGCAAGG - Intergenic
1005549413 6:26898381-26898403 GGACCTCTGCAGCAGATGCAAGG - Intergenic
1005838613 6:29725378-29725400 GGAGCTCTTCAGCAGGGTCAGGG + Intronic
1006255638 6:32830086-32830108 CCACCTGTGCAGCAGGGACAGGG + Exonic
1007224687 6:40304688-40304710 CATACTCTGCAGCAGGGTCATGG + Intergenic
1007701357 6:43768337-43768359 GCTCCCCAGCAGCAGGGACAAGG - Intergenic
1007826642 6:44605830-44605852 GGGCCTCTCCAGCAGGGCCAAGG + Intergenic
1008033301 6:46720500-46720522 GGTCCTATGCACCAGTGCCAGGG + Intronic
1010522019 6:76849572-76849594 GGTGCTCTGCCCCAGGGAGATGG + Intergenic
1011235542 6:85212779-85212801 GGTGCTCTGCCCCAGGGAGACGG + Intergenic
1011318653 6:86065404-86065426 GGTCCTCTGTCCCAGGGAGATGG + Intergenic
1013281353 6:108640051-108640073 GGTCCTCTGCATCTGGGAGCAGG - Intronic
1016542203 6:145178469-145178491 GGTCCTCTGTCCCAGGGAGACGG - Intergenic
1017322671 6:153111464-153111486 GGTGCTCTGTCCCAGGGACATGG - Intronic
1018215095 6:161518711-161518733 GGCCCTCTGCAGCAGGCAGGAGG - Intronic
1018703768 6:166448839-166448861 GTCCCTCTGCAGCAGTTACACGG - Exonic
1019060455 6:169253982-169254004 GGACCCCTGCAGCAGGTACTCGG - Exonic
1019317750 7:397816-397838 GCTCCTTTGCAGCAGAGCCACGG + Intergenic
1019402781 7:866094-866116 GCTCCTCTTCAGCATGGACTCGG + Intronic
1019980213 7:4615884-4615906 GGTCCTCTCCTACAGGGTCAGGG - Intergenic
1020884391 7:13803930-13803952 GGTCCTCTGTCCCAGGGAGATGG - Intergenic
1022003246 7:26245427-26245449 GGTCCTCCGCAGAGGGGGCATGG - Intergenic
1022027953 7:26466324-26466346 GGTCGTTTGGAGCAGGGAGATGG + Intergenic
1022242805 7:28529330-28529352 GGTCCTCTGCAGGGAGCACAGGG - Intronic
1024731219 7:52255935-52255957 GGTTCTCTGCAGCAGGTGAATGG + Intergenic
1025032857 7:55571938-55571960 GGCCCTCTGCGGCGGGGAGAGGG + Intronic
1025297602 7:57788810-57788832 GGGCCTCTCCAGCCAGGACAAGG - Intergenic
1025753049 7:64310536-64310558 AGTCCTCTGCCCCAGGCACAGGG + Intronic
1025992110 7:66504272-66504294 GGTACACTCCAGCCGGGACAGGG + Intergenic
1026973231 7:74480463-74480485 GGGACTCTCCAGCAGGGCCACGG - Intronic
1027843390 7:83342148-83342170 GGTGCTCTGTCGCAGGGAGATGG - Intergenic
1027864529 7:83629408-83629430 GGTCCTCTGTCCCAGGGAGATGG + Intronic
1029607680 7:101608980-101609002 GTTCCTCAGCAGCAGAGACAGGG + Intergenic
1029803769 7:102976026-102976048 GGTCCTCCGCAGAGGGGGCATGG - Intronic
1032499976 7:132392932-132392954 GGTCCTCTGCTGCAGGGCCTGGG - Intronic
1032513712 7:132491921-132491943 GGTCATATCCAGCAGGCACAGGG - Intronic
1033243404 7:139699628-139699650 GTCCCTCTGCACCAGGCACAAGG + Intronic
1033521193 7:142162087-142162109 GGTTATGTGCAGCAGAGACAGGG + Intronic
1033586517 7:142778684-142778706 GGTGCTCAGCAGCAGGGACTGGG + Intergenic
1035152026 7:156882597-156882619 GGTTCTCAGGGGCAGGGACAGGG + Intronic
1035373395 7:158393038-158393060 CCTTCTCTGCAGCAGGCACAGGG - Intronic
1035774130 8:2174272-2174294 CTTCCTCAGCAGCAGGGACGGGG - Intergenic
1037285431 8:17294069-17294091 GGTGCTCTGTTGCAGGGAGATGG + Intronic
1037815436 8:22109384-22109406 GGCCCGCTGCCGCAGGGACTGGG - Exonic
1037902785 8:22697348-22697370 GCTCCTCTGCAGCAGAGCCAGGG + Intergenic
1039668088 8:39559499-39559521 GGTGCTCTGCACCAGGAACCAGG - Intergenic
1040294932 8:46144242-46144264 GGTCTTTTGCAACAGAGACAGGG + Intergenic
1040817476 8:51524023-51524045 GGGCCTCTGCAGCAGGATCTGGG + Intronic
1042349393 8:67761639-67761661 GGTCCTCTGTCCCAGGGAGACGG - Intergenic
1043473703 8:80585657-80585679 GGATTTCTGCAGCAGGGAGATGG - Intergenic
1047210169 8:122834368-122834390 GGTCCTCCGCAGAGGGGGCACGG + Intronic
1048068247 8:130994176-130994198 GGTCCTCTTCAGTTAGGACATGG + Intronic
1049201658 8:141343447-141343469 GGGGCTTTGCAGAAGGGACAGGG + Intergenic
1049370217 8:142260850-142260872 GAGCCTCTGCAGCTGGGTCAGGG + Intronic
1049488659 8:142879514-142879536 GGTCCTGGGCAGCAAGGGCAGGG + Intronic
1049493558 8:142917541-142917563 GGTCCTGGGCAGCAGGGGCAGGG + Intronic
1049606563 8:143532364-143532386 GGACTTATGCACCAGGGACAGGG - Intronic
1050750579 9:8932488-8932510 GGTGCTCTGTCGCAGGGAGATGG + Intronic
1051695777 9:19766910-19766932 GGTGCTCTGCCCCAGGGAGATGG + Intronic
1052810441 9:33053758-33053780 GGTCCTCTGTATCCGGAACATGG - Intronic
1055098943 9:72443136-72443158 GGACCTCTGCAGCACTAACAAGG - Intergenic
1056137319 9:83642986-83643008 GGTCCTCTGCAGGATGTTCAGGG - Intronic
1057299983 9:93872347-93872369 GGTGCCCTGCAGCTGGGCCATGG + Intergenic
1057917177 9:99065744-99065766 TGTCCTCTGCAGGAAGGAAAGGG + Intronic
1058495075 9:105548549-105548571 GGCCCTCTGTTGCAGGGGCATGG + Intronic
1059004461 9:110385954-110385976 GGTTTTCTGCTGCAGGGCCACGG - Exonic
1060173295 9:121479098-121479120 GGTCCACTGCTGGAGAGACAAGG + Intergenic
1060977014 9:127770827-127770849 ATTCCTCTCCAGCAGGGCCAGGG - Intronic
1060978422 9:127778853-127778875 TGGCCTCAGCAGCAGGGGCAGGG + Intergenic
1061163207 9:128907787-128907809 GGTCCGCTGCAGCATGGGCACGG - Exonic
1061238042 9:129353290-129353312 GGCCCTCTCCAGGAGGGACTGGG + Intergenic
1062015299 9:134288230-134288252 CTTCCTCTGGAGCAGGGGCAGGG - Intergenic
1188552673 X:31379838-31379860 GGTCCTCCACAGATGGGACATGG - Intronic
1191805794 X:65133011-65133033 GGTCCTGTACAGATGGGACATGG + Intergenic
1192064240 X:67864355-67864377 GGTGCTCTGTACCAGGGAGATGG + Intergenic
1192282577 X:69701320-69701342 GGTCCTCCGCAGAGGGGGCATGG + Intronic
1192632662 X:72789338-72789360 GGTCCTTTGCATAAGGGATATGG + Intronic
1192649047 X:72931463-72931485 GGTCCTTTGCATAAGGGATATGG - Intronic
1193878773 X:86896377-86896399 GGTCCTCTGTCCCAGGGAGATGG - Intergenic
1194543563 X:95204731-95204753 AGTTATCTGCAGCAGGAACATGG - Intergenic
1195232976 X:102869798-102869820 GGTGCTCTGCCCCAGGGAGATGG + Intergenic
1196273127 X:113735622-113735644 GGTGCTCTGTACCAGGGAGATGG + Intergenic
1196723775 X:118878127-118878149 GGCCTTCTGCATCAGGGAAATGG + Intergenic
1197806698 X:130404533-130404555 GGTCCTCTGCACCTGTGCCAAGG - Intronic
1198301016 X:135334292-135334314 GGTCCTCTGGAGCAGGCCCAGGG - Intronic
1200076086 X:153551918-153551940 GGTCCTCTGCAGGACGCCCAGGG + Intronic