ID: 922565797

View in Genome Browser
Species Human (GRCh38)
Location 1:226600912-226600934
Sequence GGCGAATGACAGAGGAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 304}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922565797_922565801 0 Left 922565797 1:226600912-226600934 CCTCCTTTCCTCTGTCATTCGCC 0: 1
1: 0
2: 0
3: 26
4: 304
Right 922565801 1:226600935-226600957 ACATCTCCCCTACCCCAGCATGG No data
922565797_922565802 1 Left 922565797 1:226600912-226600934 CCTCCTTTCCTCTGTCATTCGCC 0: 1
1: 0
2: 0
3: 26
4: 304
Right 922565802 1:226600936-226600958 CATCTCCCCTACCCCAGCATGGG 0: 1
1: 0
2: 1
3: 20
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922565797 Original CRISPR GGCGAATGACAGAGGAAAGG AGG (reversed) Intronic
900471897 1:2859203-2859225 GGGGAAGGAGGGAGGAAAGGAGG + Intergenic
900614608 1:3559659-3559681 TGCGGAAGACACAGGAAAGGAGG + Intronic
902130528 1:14256494-14256516 GGAGACAGAGAGAGGAAAGGAGG + Intergenic
903049078 1:20587637-20587659 GGGGAAAGGCAGGGGAAAGGAGG - Intergenic
905362319 1:37429626-37429648 GGGGAGAGAGAGAGGAAAGGGGG - Intergenic
905362324 1:37429645-37429667 GGAGAAAGAGAGAGGGAAGGGGG - Intergenic
905362330 1:37429666-37429688 GGAGAAAGAGAGAGGAAAGGGGG - Intergenic
905362335 1:37429687-37429709 GGGGAGAGAGAGAGGAAAGGGGG - Intergenic
905793305 1:40801739-40801761 GGACAATGACAGAGGAGAAGGGG + Intronic
907931492 1:59005284-59005306 GGGGGATGGCAGAGGAAATGAGG + Intergenic
909389327 1:75100609-75100631 GGAGAAAGACAGAGGGAAGCTGG - Intergenic
909805770 1:79872779-79872801 GGAGAATGAGAGAGTGAAGGGGG - Intergenic
909933921 1:81529253-81529275 GGTGAAGGACAGTGGAAAGAAGG + Intronic
911812319 1:102298428-102298450 GGAGACAGACAGAGTAAAGGTGG - Intergenic
913067035 1:115265596-115265618 TGAAAATGACAGAGGAAAGTGGG - Intergenic
914920715 1:151845651-151845673 GGGGAAAGACAGAGGTGAGGAGG - Intergenic
915707781 1:157862848-157862870 GGCCAATGACTCAGGTAAGGGGG + Intronic
915875014 1:159603228-159603250 GGGAAATGACAGAGGAGAGAAGG + Intergenic
916035397 1:160918000-160918022 GGCAATTTACAGAGGAAAGAGGG + Intergenic
917773836 1:178311663-178311685 GGCAAGTGAGAGAAGAAAGGTGG - Intronic
918526260 1:185468018-185468040 TGCAAATTCCAGAGGAAAGGAGG - Intergenic
920266378 1:204726551-204726573 GAAGAATGACAGAGGGCAGGGGG - Intergenic
920859655 1:209695100-209695122 GGAGAGAGACAGAGCAAAGGGGG - Intronic
921673067 1:217947811-217947833 GGCTAATCACAGAGGTAAAGTGG - Intergenic
922175978 1:223197999-223198021 AGGGAATGAGGGAGGAAAGGAGG - Intergenic
922565797 1:226600912-226600934 GGCGAATGACAGAGGAAAGGAGG - Intronic
1063651885 10:7946242-7946264 GGTGAAGGCAAGAGGAAAGGAGG - Intronic
1063800271 10:9569033-9569055 GGGGAAAGAAAGAGGGAAGGAGG - Intergenic
1063820903 10:9834090-9834112 GGCTACTGACAGAAGAGAGGAGG - Intergenic
1065197520 10:23280961-23280983 GAGGAATGACAGAGGAGAGTGGG + Intronic
1065503143 10:26401396-26401418 GGTGGATGACAGTGGCAAGGAGG - Intergenic
1067251852 10:44593314-44593336 GGAGAAAGAGAGAGGAAGGGAGG + Intergenic
1067359308 10:45563014-45563036 GGGGAAGGAGAGAGGAAGGGAGG - Intronic
1068999626 10:63248841-63248863 GACGAATGATATAGGAAATGTGG + Intronic
1069543642 10:69313950-69313972 GGCAAATGAAAGAGAAAAGGAGG + Intronic
1070574871 10:77670367-77670389 AGAGAATGAGAGAGGAAAGGGGG + Intergenic
1073081432 10:100863375-100863397 GACGAGTGACAGAGGGAAGGAGG + Intergenic
1073825542 10:107316367-107316389 GGGGAAAGAGAGAGGAAATGGGG - Intergenic
1074676239 10:115854636-115854658 GGGAAGTGACAGAGGAAAGGGGG - Intronic
1076868264 10:133179977-133179999 GGCGTCTGGCAGAGGAAGGGAGG - Intronic
1079444317 11:20545756-20545778 GGGGAAGGGCAGAGGAAGGGCGG - Intergenic
1079451122 11:20600718-20600740 GTTGAATGACAAAGGAAATGGGG + Intronic
1080695461 11:34599917-34599939 GACAAGTGACAGTGGAAAGGAGG - Intergenic
1081050652 11:38336687-38336709 GGAGAATGAGAGAGCAAAGGAGG + Intergenic
1081555588 11:44157756-44157778 GGGGAAGGAGAGAGAAAAGGGGG - Intronic
1081589418 11:44410791-44410813 GCAGAATAAGAGAGGAAAGGAGG + Intergenic
1082900796 11:58249186-58249208 GGAGAGTGAAAGATGAAAGGAGG - Intergenic
1083712862 11:64559588-64559610 GACAAAGGACAGAGGAGAGGAGG - Intronic
1084073595 11:66754707-66754729 TGGGAATGAGAGAGAAAAGGGGG + Intronic
1084095714 11:66909799-66909821 GGTGAGTGACAGAGGACCGGCGG + Intronic
1085040528 11:73323944-73323966 GGAGAAGGACAGAGGACAGAAGG - Intronic
1086821708 11:91443610-91443632 GGAGAAAGAGAGAGTAAAGGGGG + Intergenic
1087864566 11:103207945-103207967 GGTGAATGACAGTGAAGAGGTGG + Intronic
1088255612 11:107900777-107900799 GGCAACTGACAGTGGAAATGAGG + Intronic
1090654378 11:128831761-128831783 GGCCCAGGACAGAGGAAACGAGG + Intergenic
1091468743 12:708590-708612 GAAGAATGAAACAGGAAAGGAGG - Intergenic
1092692828 12:11133528-11133550 GGCACATAACAGAAGAAAGGAGG + Exonic
1094629332 12:32157713-32157735 GGCCAAAGACAGAAAAAAGGGGG - Intronic
1095734922 12:45546457-45546479 GCTCAATGACAGAGGGAAGGAGG - Intergenic
1095763223 12:45864807-45864829 GGCAAATGACTGATAAAAGGGGG - Intronic
1098452968 12:70641204-70641226 TGCAAATGCCAGAGGAAGGGAGG - Intronic
1098472845 12:70865423-70865445 TCCAAATGACAGAGGACAGGTGG + Intronic
1100095402 12:91027627-91027649 GGAGGAAGACAGAGGAGAGGAGG - Intergenic
1101171219 12:102097111-102097133 AGCAAATGACAGAGCACAGGAGG + Intronic
1101858395 12:108463024-108463046 AGGGAAAGACAGAGGAAGGGAGG + Intergenic
1102198965 12:111044372-111044394 GGAGAATGACAGGGGACGGGAGG - Intronic
1105939493 13:25134621-25134643 GGCAAAAGACAGAGGAGAGGAGG + Intergenic
1106004794 13:25758687-25758709 GGTGAATGGCAGAGAAAAGATGG - Intronic
1106023667 13:25937872-25937894 GACCAAAGACATAGGAAAGGAGG + Intronic
1107447848 13:40484228-40484250 GGCGAATGACAGAGAGGAAGAGG + Intergenic
1107962988 13:45575431-45575453 GGCGAGTGAGGGAGGGAAGGAGG + Intronic
1108185042 13:47880373-47880395 GGAGAAAGAGAGAGGGAAGGAGG + Intergenic
1111557016 13:89893940-89893962 GGACAATGACAGATGAAAGTGGG - Intergenic
1112315881 13:98361719-98361741 GGCTAATGACAGATTGAAGGAGG - Intronic
1112315890 13:98361778-98361800 GGCTAATGACAGATCAAAGGAGG - Intronic
1112570845 13:100591612-100591634 GGAGAAAGAGAGAGCAAAGGAGG + Intergenic
1112929432 13:104715561-104715583 GGAGAAAGACAGAGAGAAGGGGG + Intergenic
1112940071 13:104850854-104850876 GGCTCATGACACAGGAATGGTGG - Intergenic
1113307240 13:109091685-109091707 GGTGAAGGGGAGAGGAAAGGAGG - Intronic
1113871606 13:113563295-113563317 GATAAATGCCAGAGGAAAGGGGG + Intergenic
1114272239 14:21108005-21108027 GGGGAAGGAGAAAGGAAAGGAGG + Intergenic
1114367701 14:22047710-22047732 GAGGAAAGACAGAAGAAAGGAGG - Intergenic
1114412929 14:22517637-22517659 GGGCAATGACAGAGGGAAGATGG + Intergenic
1114434212 14:22690618-22690640 GGAGAATGCCAGAGGATAGATGG - Intergenic
1114530049 14:23389796-23389818 GGGGAATGCCAGAGGGCAGGAGG + Intronic
1115546709 14:34470667-34470689 GGGGAATGAGAAAGAAAAGGAGG + Intergenic
1116857548 14:49966397-49966419 GGAGCATGACAGAGGAGAGGTGG + Intergenic
1118319862 14:64746735-64746757 GGGGAAGGAGAGAGGGAAGGAGG + Exonic
1118456344 14:65948461-65948483 GGAGAATGCCAGAGGAATGCGGG + Intergenic
1120572822 14:86143074-86143096 AGAGAATGACAGAGGAGAGGTGG + Intergenic
1120823511 14:88934655-88934677 GGCTAATGACAGAAGGAAGCAGG - Intergenic
1120873776 14:89360479-89360501 GGGGAAGGAAAGAGGAAGGGAGG + Intronic
1121504769 14:94468396-94468418 GGAGAGGGACAGAGGAAGGGAGG + Intronic
1122192643 14:100058952-100058974 TGTGAAGGACAGAGGAAATGAGG + Intronic
1124233674 15:27968343-27968365 GGGGAATGACAGGGGCAGGGTGG + Intronic
1125004798 15:34805377-34805399 GGCAAATGACTTAGGAAAAGTGG - Intergenic
1125575944 15:40755414-40755436 GGCCCAAGACAGGGGAAAGGCGG + Exonic
1126176695 15:45742743-45742765 GGGAAATGACAGGGGCAAGGGGG - Intergenic
1126592189 15:50351643-50351665 GGAGAAGGAGAGAGGAAAGAGGG + Intronic
1129017953 15:72485677-72485699 CAGGAATGACTGAGGAAAGGGGG - Intronic
1131526168 15:93154454-93154476 AGCGAATGACAGAGGGAAAGGGG - Intergenic
1132129655 15:99264238-99264260 GGCGCATGATAGAGGAGAGAGGG + Intronic
1132560134 16:589853-589875 GGCCAATGGCTGAGGGAAGGAGG + Intronic
1134691142 16:16191722-16191744 GAGGAAGGACAGAGGGAAGGAGG - Intronic
1136454136 16:30370786-30370808 GGTGAATGACCGCGGAAGGGCGG + Intergenic
1137268437 16:46886667-46886689 GGTGAATGAGACAGAAAAGGTGG + Intronic
1138601883 16:58060457-58060479 GGCGACTAACAGAGGACAGAGGG + Intergenic
1138813530 16:60178277-60178299 TGGGACTGAGAGAGGAAAGGAGG - Intergenic
1139005144 16:62560714-62560736 GGCAAATAACAGAGCAAAGAAGG - Intergenic
1139523503 16:67498994-67499016 GGCCTAGGACAGAGGAGAGGGGG + Intergenic
1139645255 16:68324724-68324746 GGTGAAGGACAGAGGACAGAAGG + Exonic
1139732619 16:68959649-68959671 AGCCAGTGACAGAGGCAAGGTGG - Intronic
1141209682 16:81965665-81965687 GGGAAATGAGAGGGGAAAGGCGG + Intergenic
1144843039 17:18200265-18200287 GAGGAATGAAAGAGGGAAGGAGG + Intronic
1145925991 17:28647081-28647103 TGCAATTGACACAGGAAAGGAGG + Intergenic
1146529990 17:33600262-33600284 GACAAAAGAGAGAGGAAAGGAGG - Intronic
1147421112 17:40322607-40322629 GGCGAGGGACAGAGGGAAGGAGG - Intronic
1148130099 17:45257203-45257225 GGCACCTGACAGGGGAAAGGAGG + Exonic
1148576329 17:48713971-48713993 GACGGAGGACAGAGGAAAGGTGG - Intergenic
1148638257 17:49165623-49165645 GGGGAAAGAGAGAGGAAGGGTGG - Intronic
1148695413 17:49555564-49555586 GGGGCATGAAACAGGAAAGGAGG + Intergenic
1148974146 17:51512093-51512115 GGCCAATGACAGAGCACAGCAGG - Intergenic
1150691516 17:67371170-67371192 GGCGAATGTCCTAGGAAATGAGG + Intergenic
1151642549 17:75406468-75406490 GGCTAAGTACAGAGGAACGGAGG + Intergenic
1153102537 18:1489699-1489721 GGGGAATGTAAGAGGAAAAGTGG - Intergenic
1153695342 18:7634590-7634612 AGCAAATTTCAGAGGAAAGGAGG - Intronic
1155972662 18:32095996-32096018 GGGGAATGCCAGAGTCAAGGAGG + Intronic
1156056349 18:33009211-33009233 GGTCAAAGACAGAGGAAGGGAGG - Intronic
1157410436 18:47458693-47458715 GAGGAAAGAGAGAGGAAAGGAGG + Intergenic
1159034954 18:63267829-63267851 AGAGAAAGACAGAGGGAAGGAGG - Intronic
1159798620 18:72869839-72869861 GGCGGAGGACAGAAGAAATGGGG + Intergenic
1160014602 18:75130861-75130883 GGATAATGGCAGAGGAAAGCTGG - Intergenic
1160583641 18:79901193-79901215 GGGGAATGACGGGGGATAGGAGG + Intergenic
1162420845 19:10565436-10565458 TGAGGATGAAAGAGGAAAGGGGG + Intronic
1162804386 19:13129454-13129476 GGCCAATCACAGAGGGATGGAGG + Intronic
1163207223 19:15812540-15812562 GGAGAGTGAGGGAGGAAAGGAGG + Intergenic
1164816903 19:31211374-31211396 GTCTAATGACAGAGGTAAGATGG + Intergenic
1165647597 19:37455792-37455814 GGCCAATGACACATGAAAGAAGG + Intronic
1166329340 19:42069528-42069550 GGGGAAGGAGGGAGGAAAGGAGG + Intronic
1167486627 19:49766859-49766881 GGCCAATGAGAGAGGAAGTGGGG + Intergenic
1167622554 19:50567803-50567825 GGGGGATGGCAGAGGACAGGGGG - Intronic
1167646900 19:50710867-50710889 GCAGAAAGCCAGAGGAAAGGGGG - Intronic
925287391 2:2724704-2724726 GGTGAATGACAGCAGAAAGCAGG - Intergenic
926689656 2:15724605-15724627 GGGGAAGGAGAGAGGAGAGGAGG + Intronic
928654484 2:33435754-33435776 GTAGAATGACAGAGTAAGGGAGG + Intergenic
928749769 2:34457997-34458019 GGAGAAAGACAGACAAAAGGGGG - Intergenic
929058749 2:37901962-37901984 GGAGAATGAAAGAGAGAAGGAGG - Intergenic
929091168 2:38218568-38218590 TGAAGATGACAGAGGAAAGGTGG + Intergenic
929324013 2:40583854-40583876 TGAGAAAGACAAAGGAAAGGTGG - Intronic
932777891 2:74539425-74539447 GGAGAAGGGAAGAGGAAAGGTGG + Intronic
934667812 2:96185715-96185737 GGCTAAAGTCAGAGGAATGGGGG - Exonic
936712664 2:115150209-115150231 GGCGAATGACTGAGTGCAGGCGG - Intronic
938966018 2:136389249-136389271 AGGGAGTGACAGAGGAAAAGGGG - Intergenic
942944188 2:181655850-181655872 GGTGAAAGACAGATGAAATGGGG - Intronic
943010579 2:182443540-182443562 GGAGAGAGACAGAGCAAAGGAGG - Intronic
943338402 2:186646636-186646658 GGAGAATGACAGAAGTAAGGAGG - Intronic
945067514 2:205959735-205959757 GGCGAAAGATGGAGGACAGGAGG + Intergenic
945432509 2:209780734-209780756 GGCAAATGAAAGATGTAAGGCGG - Intronic
946226166 2:218265182-218265204 GAGGAATGACAGAGGCAGGGCGG + Intronic
948175804 2:235941877-235941899 GGCGAAGCACAGAGGAAGGAAGG + Intronic
948718190 2:239879791-239879813 GGTGAGAGACAGGGGAAAGGAGG - Intergenic
1168989133 20:2079360-2079382 GGAGAATGACAGCGGGAAGGAGG - Intergenic
1169146230 20:3254405-3254427 GGAGGATGAAAGAGGAGAGGGGG - Intronic
1169779510 20:9293974-9293996 GGAGAATGTAAAAGGAAAGGTGG + Intronic
1169971767 20:11276077-11276099 GACAAAGGAGAGAGGAAAGGAGG - Intergenic
1170594040 20:17792267-17792289 GGGGAAGGACATGGGAAAGGAGG + Intergenic
1170888945 20:20363640-20363662 GGCGGAGGAGAGAGGAACGGCGG + Intergenic
1172653441 20:36522085-36522107 GGAGAATGACAGAGGTGGGGAGG - Intronic
1173158914 20:40638147-40638169 AGAAAATGACAGAGGAAAGGGGG + Intergenic
1173239441 20:41280829-41280851 GGGAAATGAGAGGGGAAAGGAGG + Intronic
1173717157 20:45218540-45218562 AGGGAATGAGAGAGGAAAGAGGG + Intergenic
1174105370 20:48158291-48158313 GGAGAAGGAAGGAGGAAAGGAGG - Intergenic
1174523765 20:51155238-51155260 GAGCAATGACAGGGGAAAGGAGG + Intergenic
1175435986 20:58948819-58948841 GCCGAATGACCGTAGAAAGGTGG - Intergenic
1177686847 21:24448010-24448032 GGCGAATAACAGAGTAATTGTGG - Intergenic
1178769633 21:35491005-35491027 GGAGAATGAAACAGGGAAGGAGG + Intronic
1179180591 21:39041630-39041652 CATGCATGACAGAGGAAAGGAGG + Intergenic
1180121358 21:45750560-45750582 GGGGAACGAAAGAGGGAAGGAGG - Intronic
1181927818 22:26374721-26374743 GGAGAATGGCAGAGGAAACCTGG + Intronic
1182028977 22:27142653-27142675 GGCAAATGACTAAGGAAATGAGG - Intergenic
1183229110 22:36569901-36569923 GGGGAATGACAGAAGAGAGAAGG + Intronic
949240585 3:1866430-1866452 GGAGAAAGACAGAGAAAGGGAGG - Intergenic
950193252 3:10992478-10992500 GGAGAATGCGAGAGGAAAGAAGG + Intergenic
950623696 3:14228532-14228554 GGCAAATGTTAGAGGAAAAGAGG + Intergenic
951972580 3:28463855-28463877 AGGGAAGGACAGAGGAAAGGAGG + Intronic
953128263 3:40112302-40112324 GGAGAGTGAAAGAAGAAAGGAGG + Intronic
953424545 3:42782671-42782693 GACAAATGGCAGAGGATAGGGGG - Intronic
955465786 3:59235939-59235961 AGCAGATGAGAGAGGAAAGGGGG - Intergenic
955494866 3:59520684-59520706 GGGGAATGGGAGAGGAAGGGTGG - Intergenic
955887767 3:63618921-63618943 GGAGAATGAGACAGGAAAGGAGG + Intergenic
956937231 3:74116981-74117003 GGGGAATGACTGGTGAAAGGTGG - Intergenic
957580576 3:82067363-82067385 GGAGTAGCACAGAGGAAAGGTGG - Intergenic
957809955 3:85208631-85208653 GCAGAATGACAGAGGTAAAGAGG + Intronic
959572965 3:107905313-107905335 GGAAAATGACAGAGGAGAAGGGG - Intergenic
959901339 3:111665110-111665132 AGCAAATGACAAAGTAAAGGGGG + Intronic
962311171 3:134327785-134327807 GGAGCCTGACAGAGGAAGGGTGG + Intergenic
962404116 3:135085720-135085742 TGGGAAAGACAGAGGCAAGGAGG - Intronic
963597424 3:147346111-147346133 TGAGAATGACAGAGAAAAAGGGG - Intergenic
963769789 3:149378439-149378461 AGAGAAGGAAAGAGGAAAGGAGG + Intergenic
965688918 3:171334395-171334417 GGAGAATGACAGAGAAGAGAGGG + Intronic
966334416 3:178852421-178852443 GGCAAATAACAGAGGGAAGTAGG + Intergenic
966879755 3:184343444-184343466 AGGGAATGAAAGATGAAAGGAGG - Intronic
969106783 4:4812315-4812337 GGAAAAGGACAGAGGAAGGGAGG + Intergenic
969129270 4:4979565-4979587 GGCAAATGAGACAGGAAAGCAGG - Intergenic
971367257 4:25987223-25987245 GGGAGACGACAGAGGAAAGGAGG - Intergenic
971846396 4:31924225-31924247 AGAGAAAGAGAGAGGAAAGGAGG - Intergenic
972265229 4:37453492-37453514 GGCGAATGCCAGAAATAAGGAGG + Intergenic
972300425 4:37780464-37780486 GGAGAAATACAGAGTAAAGGGGG + Intergenic
975151689 4:71029673-71029695 GGGGAATGACAGAAGGAAGCTGG - Exonic
975197726 4:71545034-71545056 GGTGTAAGGCAGAGGAAAGGAGG - Intronic
979733403 4:124052515-124052537 GAAGAAAGGCAGAGGAAAGGAGG + Intergenic
979853758 4:125606527-125606549 GGCAGATCACAGAGGAATGGAGG + Intergenic
980999651 4:139816530-139816552 GGGGAGGGAGAGAGGAAAGGAGG + Intronic
981610453 4:146588547-146588569 GTCAAAAGACAGAGGGAAGGGGG + Intergenic
983283501 4:165710429-165710451 GGAGAATGATAGAGGGAAGAAGG - Intergenic
984181168 4:176484261-176484283 GGGGAATGAGGCAGGAAAGGAGG + Intergenic
984489136 4:180410170-180410192 AGGGAATGACAAAGGAAATGGGG - Intergenic
985055960 4:186035779-186035801 GGCACATGACAGGGGAAATGTGG + Intergenic
985290463 4:188381262-188381284 GATGGATGAGAGAGGAAAGGTGG - Intergenic
985385353 4:189440705-189440727 AGGGAAGGACAGAGGAAAGCAGG - Intergenic
986026654 5:3857642-3857664 GGGCAATGACAGAGGCAGGGAGG + Intergenic
986196044 5:5537067-5537089 GGAGAATGACAGGGGACAGCAGG + Intergenic
987178368 5:15340224-15340246 GGGGAGAGACAGAGGAAAGTGGG + Intergenic
987806861 5:22780517-22780539 GGAGAAGTACAGAGCAAAGGAGG + Intronic
988502965 5:31798935-31798957 TGCAAATGACACAGGAATGGAGG - Exonic
988686535 5:33530602-33530624 GGAGAAAGACAGAGGAAGGGTGG + Intronic
989157157 5:38355115-38355137 GGAGAATGAGACAGGAAAGGAGG + Intronic
990370737 5:55115587-55115609 GGAGAATGAGGGAGGAAAGGAGG + Intronic
990754615 5:59055256-59055278 AGGGATTGACAGAGGAAGGGAGG - Intronic
991020418 5:61974154-61974176 CACAAATGACAGAGGAAAGCAGG - Intergenic
991172584 5:63646026-63646048 GGAGGAAGACAGAGGAAAGGAGG + Intergenic
991262666 5:64683990-64684012 GGTGAAAGAGAGAGAAAAGGGGG + Intergenic
991442107 5:66661546-66661568 GGCTAATGAGAAAGAAAAGGAGG + Intronic
992381333 5:76240654-76240676 AGAGACTGAGAGAGGAAAGGAGG - Intronic
992401019 5:76411599-76411621 GGTGAAAGAGAGAGAAAAGGAGG - Intronic
994572421 5:101531158-101531180 GGAGACTGAAAGAGTAAAGGGGG + Intergenic
994741556 5:103625490-103625512 GGAGGATGAGAGAGGAAAAGAGG + Intergenic
999192814 5:149761410-149761432 GCTGAAGGACAGAGGAAATGGGG - Intronic
1001545375 5:172567735-172567757 GCAGAAGGAAAGAGGAAAGGAGG - Intergenic
1002164646 5:177336839-177336861 GGCCATTTACAGAAGAAAGGAGG + Intronic
1002164660 5:177336915-177336937 GGCCATTTACAGAAGAAAGGAGG + Intronic
1002164676 5:177336991-177337013 GGCCATTTACAGAAGAAAGGAGG + Intronic
1002279682 5:178123043-178123065 AGCGCAGGACAGAGGCAAGGTGG - Exonic
1003021044 6:2509924-2509946 GGCGAACGACAGAGCGCAGGTGG - Intergenic
1005862588 6:29912881-29912903 TGCCAATGACTGAGGAAAGCAGG + Intergenic
1006337841 6:33429897-33429919 GCAGAAACACAGAGGAAAGGGGG - Intronic
1006905198 6:37528551-37528573 GGGGAATGACAGTGAAAAGCCGG + Intergenic
1007209017 6:40176754-40176776 GGAGAATGGCAGAGGAAGAGAGG - Intergenic
1008834707 6:55811666-55811688 GGAGAAAGAGAGAGGGAAGGAGG - Intronic
1009628207 6:66163516-66163538 GGGGAAGGAGAAAGGAAAGGGGG + Intergenic
1010704421 6:79090223-79090245 GGGGAATGAAGGAGGGAAGGAGG - Intergenic
1011598442 6:89038287-89038309 GGAGAAGTACAGAGCAAAGGGGG + Intergenic
1011719858 6:90144333-90144355 TGGGAAGGACAGAGGGAAGGAGG + Intronic
1012171599 6:96023478-96023500 GGCAAATGGCAGAGGAATGTTGG + Intronic
1013190675 6:107802471-107802493 GCAGAGTGACAGAGGGAAGGCGG + Intronic
1013627922 6:111955986-111956008 GGAGAAGGACATAGTAAAGGAGG + Intergenic
1015881039 6:137870032-137870054 GGCAAATGAAGGAGGAAAGGTGG - Intronic
1016917676 6:149259989-149260011 GGCAAAAGTCAGGGGAAAGGGGG - Intronic
1018129708 6:160717385-160717407 GACACATGTCAGAGGAAAGGAGG - Intronic
1018226335 6:161632781-161632803 GGAGAAGTACAGAGCAAAGGTGG + Intronic
1018739980 6:166721196-166721218 GACAAATAACACAGGAAAGGTGG + Intronic
1018789435 6:167135298-167135320 TCCAAATGCCAGAGGAAAGGTGG - Intronic
1019170812 6:170132296-170132318 GCCGCAACACAGAGGAAAGGGGG + Intergenic
1019960516 7:4455591-4455613 GGGAGATGACAGAGGAAGGGAGG - Intergenic
1020704457 7:11526694-11526716 GGAGAAAGAGAGGGGAAAGGGGG - Intronic
1020740932 7:12017379-12017401 AGAGCATGGCAGAGGAAAGGAGG + Intergenic
1021692374 7:23243076-23243098 GGCCAATGAGACAGGAAATGTGG + Intronic
1021855482 7:24850689-24850711 GGCCAATGACAGAGGTAGGGAGG + Intronic
1022514722 7:30968314-30968336 GGAGAATGACACAGGGAAGGAGG + Intronic
1022972965 7:35534101-35534123 GGAGAAAGACAGAACAAAGGGGG - Intergenic
1023414028 7:39915618-39915640 AGAGAAAGAAAGAGGAAAGGAGG - Intergenic
1023516419 7:41006281-41006303 AGCTAATGAAAGAGGAAATGAGG - Intergenic
1024919982 7:54545662-54545684 GGGGAAAGAGAGAGGGAAGGGGG + Intronic
1025107654 7:56185655-56185677 GGGGTATGACAGAGCAAAGTGGG - Intergenic
1026124828 7:67570373-67570395 GGGGATTGACAGTGGGAAGGGGG + Intergenic
1026501853 7:70949360-70949382 GGGGGATGACAGATAAAAGGTGG - Intergenic
1028516931 7:91688012-91688034 GGACAATAACAAAGGAAAGGTGG + Intergenic
1029689168 7:102169449-102169471 GGCGAATGACATGGGACACGTGG - Intronic
1029950951 7:104585080-104585102 GGAGAAGGACAGAGGACAAGAGG - Intronic
1029971440 7:104793288-104793310 GGGGAAAAACAGAGGAGAGGTGG + Intronic
1032442853 7:131955381-131955403 GGAAAGTGATAGAGGAAAGGAGG + Intergenic
1033952758 7:146805552-146805574 GCAGAATGAAAGAGGAAAGAAGG + Intronic
1035494316 7:159309406-159309428 GGAGAAAGAGAGAGCAAAGGGGG + Intergenic
1036452881 8:8883798-8883820 GGGGAATGAGTGGGGAAAGGAGG - Intronic
1037635692 8:20699803-20699825 AGAGAATGAAAGAGGAGAGGGGG - Intergenic
1038055577 8:23854571-23854593 GGAGAGGGAAAGAGGAAAGGGGG - Exonic
1042296744 8:67227367-67227389 GGAGAAAAACAGAAGAAAGGGGG - Intronic
1043417243 8:80063904-80063926 GGGGAATGGCAGAGGGAGGGAGG + Intronic
1043918772 8:85956885-85956907 GGGGAATGGAAGAGGAAATGGGG - Intergenic
1045049148 8:98307022-98307044 GGAGAATGAGAGAGGAAGGAAGG - Intergenic
1045959930 8:107954937-107954959 GGCGAATGACAGAAGAGAAAAGG - Intronic
1046819727 8:118621882-118621904 GGCGAAAGCGAGAGGAAGGGGGG - Exonic
1048038872 8:130706081-130706103 GGAGAGAGACAGAGCAAAGGGGG + Intergenic
1048510174 8:135054962-135054984 GGTGAATGCCAGAGTGAAGGTGG + Intergenic
1048560840 8:135535906-135535928 GGAGAAGGACATAGGATAGGTGG + Intronic
1049256058 8:141614472-141614494 GGACAAGGACAGAGGAGAGGGGG + Intergenic
1049348387 8:142151179-142151201 GGTGAATGACAGAGGATAGATGG + Intergenic
1049526106 8:143127691-143127713 GGGGAATGAGAGGGGAATGGTGG + Intergenic
1050280708 9:4047195-4047217 GGCGAGAGACAGAGCGAAGGGGG - Intronic
1050377850 9:4991741-4991763 GGCAAAGTACAGAGGACAGGTGG - Intronic
1053382842 9:37662741-37662763 GGAGAATAAGAGAGGAAAGAAGG - Intronic
1055677791 9:78682854-78682876 GGAGAAGGAGAGAGGGAAGGGGG - Intergenic
1056401285 9:86229943-86229965 GGAGAAAGAAAGAGCAAAGGGGG + Intronic
1057407440 9:94785909-94785931 GGAGAATGACAGCCTAAAGGGGG - Intronic
1060149556 9:121279546-121279568 GGAGAGTGACAGAGCAAAAGGGG + Intronic
1060592753 9:124829323-124829345 GGAGAAAGACAGAGGAAGGAAGG - Intergenic
1061082988 9:128383361-128383383 GGGGAGTAACAGAGGAGAGGGGG - Intronic
1062198317 9:135286967-135286989 GGCTATTGGCAGAGCAAAGGAGG + Intergenic
1062269037 9:135700356-135700378 GGGGGATGACGGAGGGAAGGGGG + Intergenic
1062386688 9:136314901-136314923 GGCTGATGCCAGAGGAAGGGTGG + Intergenic
1185751161 X:2610425-2610447 GGCGAGAGAAAGAGGAAAGAGGG - Intergenic
1185824910 X:3240799-3240821 GGAGAAAGAAAGAAGAAAGGAGG - Intergenic
1186235182 X:7500165-7500187 AGAGAGTGAGAGAGGAAAGGAGG - Intergenic
1186246727 X:7622866-7622888 AGGGAAGGACAGAGGAAGGGAGG - Intergenic
1186455873 X:9709430-9709452 ACCGGATGACAGAGGAAGGGAGG - Intronic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic
1188616655 X:32165898-32165920 GGAGAAGTACTGAGGAAAGGGGG - Intronic
1189988862 X:46576143-46576165 GGGAAATGAGAGAGGGAAGGAGG - Intronic
1190439525 X:50463398-50463420 GGAGAGAGACAGAGGAAGGGAGG - Intronic
1190640386 X:52478441-52478463 GGAGAAGGACAGCTGAAAGGAGG + Intergenic
1190647286 X:52534424-52534446 GGAGAAGGACAGCTGAAAGGAGG - Intergenic
1192313344 X:70034055-70034077 GGAGAATGACAGCAGGAAGGAGG - Intronic
1193347777 X:80424013-80424035 GGAGAATAAGAGAGAAAAGGTGG - Intronic
1194363987 X:92990790-92990812 GGAGAAAGAGAGAGCAAAGGGGG - Intergenic
1195237647 X:102917557-102917579 AGGGAATGACAGAGAGAAGGTGG + Intergenic
1195950884 X:110271371-110271393 GGCAAATGCCAGAGGAAGGAAGG + Intronic
1196576206 X:117322131-117322153 GGAGAAGGGCAGAGCAAAGGTGG - Intergenic
1198460447 X:136858017-136858039 GGTGAAGGACAGAGAAAAGCAGG - Intronic
1198963859 X:142207765-142207787 GGGGAGTGACAAAGAAAAGGTGG - Intergenic
1199544978 X:148998888-148998910 GGTGATGGACAGAGGGAAGGAGG - Exonic
1200672217 Y:6107026-6107048 GGAGAAAGAGAGAGCAAAGGGGG - Intergenic