ID: 922568378

View in Genome Browser
Species Human (GRCh38)
Location 1:226616953-226616975
Sequence GGTGTCTTTCAAGAAGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922568378_922568384 14 Left 922568378 1:226616953-226616975 CCTCTCCCTTCTTGAAAGACACC No data
Right 922568384 1:226616990-226617012 ACCAAAGATGCTTCCAGAAATGG No data
922568378_922568386 23 Left 922568378 1:226616953-226616975 CCTCTCCCTTCTTGAAAGACACC No data
Right 922568386 1:226616999-226617021 GCTTCCAGAAATGGTAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922568378 Original CRISPR GGTGTCTTTCAAGAAGGGAG AGG (reversed) Intergenic
No off target data available for this crispr