ID: 922568379

View in Genome Browser
Species Human (GRCh38)
Location 1:226616958-226616980
Sequence AAGAAGGTGTCTTTCAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922568379_922568384 9 Left 922568379 1:226616958-226616980 CCCTTCTTGAAAGACACCTTCTT No data
Right 922568384 1:226616990-226617012 ACCAAAGATGCTTCCAGAAATGG No data
922568379_922568388 26 Left 922568379 1:226616958-226616980 CCCTTCTTGAAAGACACCTTCTT No data
Right 922568388 1:226617007-226617029 AAATGGTAGTTGAGGTTTCTTGG No data
922568379_922568386 18 Left 922568379 1:226616958-226616980 CCCTTCTTGAAAGACACCTTCTT No data
Right 922568386 1:226616999-226617021 GCTTCCAGAAATGGTAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922568379 Original CRISPR AAGAAGGTGTCTTTCAAGAA GGG (reversed) Intergenic
No off target data available for this crispr