ID: 922568380

View in Genome Browser
Species Human (GRCh38)
Location 1:226616959-226616981
Sequence CAAGAAGGTGTCTTTCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922568380_922568388 25 Left 922568380 1:226616959-226616981 CCTTCTTGAAAGACACCTTCTTG No data
Right 922568388 1:226617007-226617029 AAATGGTAGTTGAGGTTTCTTGG No data
922568380_922568386 17 Left 922568380 1:226616959-226616981 CCTTCTTGAAAGACACCTTCTTG No data
Right 922568386 1:226616999-226617021 GCTTCCAGAAATGGTAGTTGAGG No data
922568380_922568384 8 Left 922568380 1:226616959-226616981 CCTTCTTGAAAGACACCTTCTTG No data
Right 922568384 1:226616990-226617012 ACCAAAGATGCTTCCAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922568380 Original CRISPR CAAGAAGGTGTCTTTCAAGA AGG (reversed) Intergenic
No off target data available for this crispr