ID: 922568381

View in Genome Browser
Species Human (GRCh38)
Location 1:226616974-226616996
Sequence CTTTGGTCAGGGATTCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922568381_922568389 22 Left 922568381 1:226616974-226616996 CCTTCTTGAATCCCTGACCAAAG No data
Right 922568389 1:226617019-226617041 AGGTTTCTTGGCCCCCTTTGAGG No data
922568381_922568386 2 Left 922568381 1:226616974-226616996 CCTTCTTGAATCCCTGACCAAAG No data
Right 922568386 1:226616999-226617021 GCTTCCAGAAATGGTAGTTGAGG No data
922568381_922568388 10 Left 922568381 1:226616974-226616996 CCTTCTTGAATCCCTGACCAAAG No data
Right 922568388 1:226617007-226617029 AAATGGTAGTTGAGGTTTCTTGG No data
922568381_922568390 27 Left 922568381 1:226616974-226616996 CCTTCTTGAATCCCTGACCAAAG No data
Right 922568390 1:226617024-226617046 TCTTGGCCCCCTTTGAGGAGAGG No data
922568381_922568384 -7 Left 922568381 1:226616974-226616996 CCTTCTTGAATCCCTGACCAAAG No data
Right 922568384 1:226616990-226617012 ACCAAAGATGCTTCCAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922568381 Original CRISPR CTTTGGTCAGGGATTCAAGA AGG (reversed) Intergenic