ID: 922568384

View in Genome Browser
Species Human (GRCh38)
Location 1:226616990-226617012
Sequence ACCAAAGATGCTTCCAGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922568380_922568384 8 Left 922568380 1:226616959-226616981 CCTTCTTGAAAGACACCTTCTTG No data
Right 922568384 1:226616990-226617012 ACCAAAGATGCTTCCAGAAATGG No data
922568381_922568384 -7 Left 922568381 1:226616974-226616996 CCTTCTTGAATCCCTGACCAAAG No data
Right 922568384 1:226616990-226617012 ACCAAAGATGCTTCCAGAAATGG No data
922568378_922568384 14 Left 922568378 1:226616953-226616975 CCTCTCCCTTCTTGAAAGACACC No data
Right 922568384 1:226616990-226617012 ACCAAAGATGCTTCCAGAAATGG No data
922568377_922568384 17 Left 922568377 1:226616950-226616972 CCTCCTCTCCCTTCTTGAAAGAC No data
Right 922568384 1:226616990-226617012 ACCAAAGATGCTTCCAGAAATGG No data
922568376_922568384 20 Left 922568376 1:226616947-226616969 CCTCCTCCTCTCCCTTCTTGAAA No data
Right 922568384 1:226616990-226617012 ACCAAAGATGCTTCCAGAAATGG No data
922568379_922568384 9 Left 922568379 1:226616958-226616980 CCCTTCTTGAAAGACACCTTCTT No data
Right 922568384 1:226616990-226617012 ACCAAAGATGCTTCCAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922568384 Original CRISPR ACCAAAGATGCTTCCAGAAA TGG Intergenic
No off target data available for this crispr