ID: 922568386

View in Genome Browser
Species Human (GRCh38)
Location 1:226616999-226617021
Sequence GCTTCCAGAAATGGTAGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922568381_922568386 2 Left 922568381 1:226616974-226616996 CCTTCTTGAATCCCTGACCAAAG No data
Right 922568386 1:226616999-226617021 GCTTCCAGAAATGGTAGTTGAGG No data
922568378_922568386 23 Left 922568378 1:226616953-226616975 CCTCTCCCTTCTTGAAAGACACC No data
Right 922568386 1:226616999-226617021 GCTTCCAGAAATGGTAGTTGAGG No data
922568380_922568386 17 Left 922568380 1:226616959-226616981 CCTTCTTGAAAGACACCTTCTTG No data
Right 922568386 1:226616999-226617021 GCTTCCAGAAATGGTAGTTGAGG No data
922568376_922568386 29 Left 922568376 1:226616947-226616969 CCTCCTCCTCTCCCTTCTTGAAA No data
Right 922568386 1:226616999-226617021 GCTTCCAGAAATGGTAGTTGAGG No data
922568382_922568386 -9 Left 922568382 1:226616985-226617007 CCCTGACCAAAGATGCTTCCAGA No data
Right 922568386 1:226616999-226617021 GCTTCCAGAAATGGTAGTTGAGG No data
922568377_922568386 26 Left 922568377 1:226616950-226616972 CCTCCTCTCCCTTCTTGAAAGAC No data
Right 922568386 1:226616999-226617021 GCTTCCAGAAATGGTAGTTGAGG No data
922568383_922568386 -10 Left 922568383 1:226616986-226617008 CCTGACCAAAGATGCTTCCAGAA No data
Right 922568386 1:226616999-226617021 GCTTCCAGAAATGGTAGTTGAGG No data
922568379_922568386 18 Left 922568379 1:226616958-226616980 CCCTTCTTGAAAGACACCTTCTT No data
Right 922568386 1:226616999-226617021 GCTTCCAGAAATGGTAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922568386 Original CRISPR GCTTCCAGAAATGGTAGTTG AGG Intergenic
No off target data available for this crispr