ID: 922569824

View in Genome Browser
Species Human (GRCh38)
Location 1:226627812-226627834
Sequence GAAAATGGACTAATGCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922569824_922569831 30 Left 922569824 1:226627812-226627834 CCCACCTGCATTAGTCCATTTTC No data
Right 922569831 1:226627865-226627887 GTAATTTATGAAGAAAAAAAAGG No data
922569824_922569829 8 Left 922569824 1:226627812-226627834 CCCACCTGCATTAGTCCATTTTC No data
Right 922569829 1:226627843-226627865 ATAAAGAACTACCTAAGACTGGG 0: 76
1: 1299
2: 4484
3: 12428
4: 14627
922569824_922569828 7 Left 922569824 1:226627812-226627834 CCCACCTGCATTAGTCCATTTTC No data
Right 922569828 1:226627842-226627864 TATAAAGAACTACCTAAGACTGG 0: 75
1: 1330
2: 4333
3: 7115
4: 13546

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922569824 Original CRISPR GAAAATGGACTAATGCAGGT GGG (reversed) Intergenic
No off target data available for this crispr