ID: 922570105

View in Genome Browser
Species Human (GRCh38)
Location 1:226629562-226629584
Sequence CCCTTGTATGTCCTCGACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 64}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922570105_922570120 27 Left 922570105 1:226629562-226629584 CCTCAGTCGAGGACATACAAGGG 0: 1
1: 0
2: 0
3: 5
4: 64
Right 922570120 1:226629612-226629634 CTGGATGGACGCTGCCTTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 118
922570105_922570119 12 Left 922570105 1:226629562-226629584 CCTCAGTCGAGGACATACAAGGG 0: 1
1: 0
2: 0
3: 5
4: 64
Right 922570119 1:226629597-226629619 GGCAGGGGCTGGGGGCTGGATGG 0: 1
1: 3
2: 33
3: 326
4: 2248
922570105_922570114 2 Left 922570105 1:226629562-226629584 CCTCAGTCGAGGACATACAAGGG 0: 1
1: 0
2: 0
3: 5
4: 64
Right 922570114 1:226629587-226629609 AGAGAGGACCGGCAGGGGCTGGG 0: 1
1: 0
2: 6
3: 32
4: 381
922570105_922570111 -4 Left 922570105 1:226629562-226629584 CCTCAGTCGAGGACATACAAGGG 0: 1
1: 0
2: 0
3: 5
4: 64
Right 922570111 1:226629581-226629603 AGGGGCAGAGAGGACCGGCAGGG 0: 1
1: 1
2: 7
3: 49
4: 463
922570105_922570109 -9 Left 922570105 1:226629562-226629584 CCTCAGTCGAGGACATACAAGGG 0: 1
1: 0
2: 0
3: 5
4: 64
Right 922570109 1:226629576-226629598 ATACAAGGGGCAGAGAGGACCGG 0: 1
1: 0
2: 4
3: 27
4: 338
922570105_922570112 -3 Left 922570105 1:226629562-226629584 CCTCAGTCGAGGACATACAAGGG 0: 1
1: 0
2: 0
3: 5
4: 64
Right 922570112 1:226629582-226629604 GGGGCAGAGAGGACCGGCAGGGG 0: 1
1: 0
2: 3
3: 59
4: 526
922570105_922570117 8 Left 922570105 1:226629562-226629584 CCTCAGTCGAGGACATACAAGGG 0: 1
1: 0
2: 0
3: 5
4: 64
Right 922570117 1:226629593-226629615 GACCGGCAGGGGCTGGGGGCTGG 0: 1
1: 2
2: 12
3: 128
4: 1193
922570105_922570115 3 Left 922570105 1:226629562-226629584 CCTCAGTCGAGGACATACAAGGG 0: 1
1: 0
2: 0
3: 5
4: 64
Right 922570115 1:226629588-226629610 GAGAGGACCGGCAGGGGCTGGGG 0: 1
1: 0
2: 7
3: 70
4: 573
922570105_922570110 -5 Left 922570105 1:226629562-226629584 CCTCAGTCGAGGACATACAAGGG 0: 1
1: 0
2: 0
3: 5
4: 64
Right 922570110 1:226629580-226629602 AAGGGGCAGAGAGGACCGGCAGG 0: 1
1: 0
2: 1
3: 30
4: 361
922570105_922570113 1 Left 922570105 1:226629562-226629584 CCTCAGTCGAGGACATACAAGGG 0: 1
1: 0
2: 0
3: 5
4: 64
Right 922570113 1:226629586-226629608 CAGAGAGGACCGGCAGGGGCTGG 0: 1
1: 1
2: 3
3: 51
4: 716
922570105_922570116 4 Left 922570105 1:226629562-226629584 CCTCAGTCGAGGACATACAAGGG 0: 1
1: 0
2: 0
3: 5
4: 64
Right 922570116 1:226629589-226629611 AGAGGACCGGCAGGGGCTGGGGG 0: 1
1: 0
2: 3
3: 79
4: 674

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922570105 Original CRISPR CCCTTGTATGTCCTCGACTG AGG (reversed) Intergenic
906213729 1:44026851-44026873 TCCTTGTAAGTGCTCGAGTGAGG + Intronic
912519161 1:110233596-110233618 CCCATCTATGTCCTTGACTTAGG + Exonic
916063607 1:161118824-161118846 CCCTTCTGTGTCCTGGACTCCGG + Exonic
922570105 1:226629562-226629584 CCCTTGTATGTCCTCGACTGAGG - Intergenic
1071075983 10:81753493-81753515 CCCTTGGATGTCATCCCCTGTGG - Intergenic
1071322804 10:84481150-84481172 CCCTTGTATTTCCTCGTTTGTGG - Intronic
1076362576 10:129899655-129899677 CCCTGGTGTGTCCTCACCTGTGG - Intronic
1077696230 11:4395308-4395330 CACTTGTATGTCTTCTTCTGAGG + Intergenic
1079329654 11:19522967-19522989 GCCTTGTGAGTCCTCAACTGTGG - Intronic
1080636779 11:34131149-34131171 CCCTTGTGTGTCCTTGTCTCAGG + Intronic
1084865194 11:72050137-72050159 GCCTTGTAGTTCCTCGAGTGTGG - Intronic
1090438968 11:126710613-126710635 CCCTTCTCTGTCCTCAGCTGGGG + Intronic
1094815420 12:34178919-34178941 CCCATGTAGGTCCCCCACTGGGG - Intergenic
1098155569 12:67594254-67594276 CCCTTGTTTGTCCCAGACAGAGG + Intergenic
1100690108 12:97030450-97030472 TCCTTCTAAGTTCTCGACTGGGG + Intergenic
1110355939 13:74567610-74567632 CCCTTGTATGTCTTCTCCTCAGG + Intergenic
1121517070 14:94559785-94559807 CCCTGGTATGTTCTGGACAGAGG - Intergenic
1121576091 14:94989473-94989495 CCCTTGTATCTCCTTGTCTCAGG - Intergenic
1121646036 14:95517250-95517272 CCCTTGTGACTCCTGGACTGTGG - Exonic
1121776977 14:96597801-96597823 CCCTTACATGTCCTCTGCTGTGG + Intergenic
1123955694 15:25332058-25332080 CCCTAGCATGTCTTGGACTGTGG + Intergenic
1125500040 15:40233960-40233982 CCCTTGCATGCCCTCCCCTGTGG - Intergenic
1126177362 15:45749273-45749295 CCCTTAGATTTCCTAGACTGTGG + Intergenic
1127094913 15:55502580-55502602 CCCTTCTAAGTTCTTGACTGGGG - Intronic
1130247447 15:82264667-82264689 CCCTTGTCAGTCCTGGTCTGTGG - Intronic
1130452647 15:84072513-84072535 CCCTTGTCAGTCCTGGTCTGTGG + Intergenic
1136711897 16:32244845-32244867 CCCTTTTATCTCCTCCCCTGAGG + Intergenic
1136756019 16:32684561-32684583 CCCTTTTATCTCCTCCCCTGAGG - Intergenic
1136812094 16:33185811-33185833 CCCTTTTATCTCCTCCCCTGAGG + Intergenic
1136818570 16:33295891-33295913 CCCTTTTATCTCCTCCCCTGAGG + Intronic
1136825134 16:33352424-33352446 CCCTTTTATCTCCTCCCCTGAGG + Intergenic
1136830200 16:33451195-33451217 CCCTTTTATCTCCTCCCCTGAGG + Intergenic
1202990672 16_KI270728v1_random:8781-8803 CCCTTTTATCTCCTCCCCTGAGG + Intergenic
1203058159 16_KI270728v1_random:944914-944936 CCCTTTTATCTCCTCCCCTGAGG - Intergenic
1148791980 17:50178333-50178355 CCCTTCTTTGTCCTGGGCTGTGG - Intergenic
1150474720 17:65466247-65466269 ACCTTGTGTGTCCTGGATTGTGG - Intergenic
1152900060 17:82935884-82935906 CCCTTGGATTTCCTCGAGTGGGG + Intronic
1165149259 19:33751345-33751367 CCCTTGGATGTCTACGTCTGAGG - Intronic
929564921 2:42978346-42978368 CCCTTGTTTGTCCTCCTCTAGGG + Intergenic
936259222 2:110943796-110943818 CCCAGGTATGTCCTGGCCTGGGG + Intronic
936743040 2:115537993-115538015 CCCTTGGATTACCTAGACTGGGG - Intronic
937937157 2:127255518-127255540 CCTGTGTCTGGCCTCGACTGGGG + Intergenic
939895533 2:147786571-147786593 CTCTTCTATGTCCTCCTCTGTGG + Intergenic
941989722 2:171543304-171543326 TCCTTGTATGTGCAGGACTGAGG + Intronic
944070438 2:195661975-195661997 CCCTTTTATATACTCGACTTTGG + Intronic
948437312 2:237962316-237962338 CCCCTTTATGTCCTGGATTGTGG + Intergenic
1169969285 20:11251480-11251502 CCCTTGTAAGTCAATGACTGGGG + Intergenic
1174273977 20:49390208-49390230 CCCTTGTTTGTCCCCCACTAAGG + Intronic
1179630074 21:42672309-42672331 CTCTTGTCTGTCCTCGTCTGTGG + Intronic
952267884 3:31803786-31803808 CCCTAGTATTTCCTAGATTGGGG + Intronic
956511297 3:69996044-69996066 TCCTTGTATGACCTTAACTGGGG - Intergenic
960742938 3:120855130-120855152 ACCTTGTACGTCCTCTAATGAGG - Intergenic
964745000 3:160003879-160003901 CCCTCCTATGTCCTGGGCTGTGG - Intergenic
972814471 4:42628945-42628967 CCCTTGGATGTCCTTAGCTGAGG + Intronic
981228983 4:142331083-142331105 CCCTTGAATTTCCTTGCCTGTGG - Intronic
984312606 4:178082112-178082134 GCCTTGTCTGTCCTCAGCTGGGG + Intergenic
990305220 5:54487834-54487856 CCCTTGTATTTCCTGGTCTAGGG - Intergenic
1014759482 6:125340741-125340763 CCCTTGTATGTCCTACAATGAGG - Intergenic
1019882475 7:3875008-3875030 CCCCTTTATGTCCTGGTCTGTGG + Intronic
1026994916 7:74609327-74609349 ACCTTGTATGTCCTGGACGTAGG - Intergenic
1027403943 7:77838563-77838585 CTACTGTATGTCCTGGACTGTGG + Intronic
1029692936 7:102194665-102194687 CCCTTGTACCTTCTCTACTGAGG - Intronic
1029971194 7:104791160-104791182 CCATTGTGTGTTCTGGACTGTGG + Intronic
1033131969 7:138752458-138752480 TTCTTTTATGTCCTCGAGTGGGG + Intronic
1055369740 9:75584373-75584395 CCCTTGGATGTCCTTGATTGAGG - Intergenic
1055377424 9:75664939-75664961 GCCTTGTGTGGCCTCGTCTGCGG + Intergenic
1057878027 9:98772530-98772552 CTCTTGTTGGTCCTCTACTGTGG + Intronic
1057900502 9:98944339-98944361 CCCTTTTATGTCCAGGAATGAGG - Intronic
1185723734 X:2402633-2402655 CCCTGGTATGTCCACTGCTGGGG - Intronic
1195936036 X:110126529-110126551 CCATTGTTTGTGCTCCACTGTGG - Intronic