ID: 922570445

View in Genome Browser
Species Human (GRCh38)
Location 1:226631636-226631658
Sequence CAGCCCTGAGACCTGGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 1, 2: 5, 3: 36, 4: 305}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922570445_922570456 20 Left 922570445 1:226631636-226631658 CCCTCAGCCAGGTCTCAGGGCTG 0: 1
1: 1
2: 5
3: 36
4: 305
Right 922570456 1:226631679-226631701 ACAGACAGCGCTGGTCTCCAAGG 0: 1
1: 0
2: 1
3: 14
4: 184
922570445_922570454 11 Left 922570445 1:226631636-226631658 CCCTCAGCCAGGTCTCAGGGCTG 0: 1
1: 1
2: 5
3: 36
4: 305
Right 922570454 1:226631670-226631692 GATCACACCACAGACAGCGCTGG 0: 1
1: 0
2: 2
3: 3
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922570445 Original CRISPR CAGCCCTGAGACCTGGCTGA GGG (reversed) Intergenic
901617854 1:10556102-10556124 CAGCGCTGAGCACTGGCAGACGG - Intronic
901632286 1:10653732-10653754 CAGCCCCGAGATCTTGCTGTTGG + Exonic
902674536 1:17999562-17999584 CAGCCCTGGGCCCAGACTGAGGG + Intergenic
902992789 1:20201090-20201112 CATCACTGTGAACTGGCTGAAGG - Intergenic
903350295 1:22712727-22712749 CAGCCCTGGGGCCTGGCTGCTGG + Intronic
903691860 1:25179809-25179831 CAGCAGTGAAGCCTGGCTGAAGG - Intergenic
904535824 1:31198790-31198812 CAGCCCTGACTCGGGGCTGAAGG - Intronic
905008308 1:34729168-34729190 CATCCCTGAGATCTGGCACAAGG + Intronic
906687846 1:47773934-47773956 TGGCTCTGAGACCTGGCTGTAGG + Intronic
908118103 1:60960951-60960973 CAGCCCTGAGACCAAGCAGAGGG + Intronic
908301491 1:62765267-62765289 CAGACCTGAGATCTGAATGAGGG - Intergenic
909138178 1:71828887-71828909 GAGCCATGAGACAAGGCTGAGGG + Intronic
909318827 1:74256220-74256242 CAGCTCTCATACCTTGCTGATGG - Intronic
911293081 1:96081312-96081334 CAGGCCTGACTCCTGGCTCATGG - Intergenic
911332613 1:96542478-96542500 CAGCCCTGAGAACGGGCAGTGGG - Intergenic
912491972 1:110067482-110067504 CAGGCCTGAGAGCTGGGTCAGGG - Intronic
915146005 1:153796128-153796150 CAGCCCTGGGACTTGGTTGTGGG + Intergenic
915276570 1:154792908-154792930 GTTGCCTGAGACCTGGCTGAAGG - Intronic
915625396 1:157111356-157111378 CAGGCCAGATCCCTGGCTGAAGG - Intergenic
919727825 1:200895322-200895344 CAGGCCTGAGACCTGGCTTTGGG + Intronic
919793070 1:201304804-201304826 AAGACCTGAGTCCTGGCTTAGGG + Intronic
919796693 1:201325313-201325335 CAGCCCTGGGGCCTGGATGCTGG - Intronic
920435594 1:205944804-205944826 GTGCCCTGACACCTGGCTGAGGG + Intergenic
922570445 1:226631636-226631658 CAGCCCTGAGACCTGGCTGAGGG - Intergenic
922584011 1:226720268-226720290 CAGCCCTGGGAGGTGGCTGAGGG - Intronic
922794628 1:228333955-228333977 CAGCCCTCTGTCCTGACTGATGG + Intronic
923035182 1:230280618-230280640 CAGGCCTGTGCCCTGGCTGACGG - Exonic
923784641 1:237055243-237055265 GAGCCCTGAGACCAGGGTCAGGG + Intronic
924380913 1:243463535-243463557 CAGCCCCAAGACCAGCCTGATGG + Intronic
1063112484 10:3048785-3048807 CAGCCCTGAGACTGGGCTGGAGG + Intergenic
1063390409 10:5646480-5646502 CAGCCCCGTGACCTTGCTCAGGG + Intronic
1063408963 10:5821971-5821993 CGGCCCTGAGACATGCATGATGG + Intronic
1065969087 10:30791651-30791673 CACAGATGAGACCTGGCTGATGG - Intergenic
1066044058 10:31580888-31580910 CAGCCCTCAGCGCTGGCTGTAGG - Intergenic
1066349341 10:34622999-34623021 CAGCTCTTATACATGGCTGAGGG - Intronic
1069797365 10:71062001-71062023 CAGCCCTGAGGCATTGCAGAGGG + Intergenic
1070616058 10:77970025-77970047 CAACCCTGAGACCTGTATGAAGG - Intronic
1072631372 10:97149146-97149168 CAGCCCTGGTGCCTGGCTGTGGG - Intronic
1073604423 10:104879760-104879782 AAGCCGTGAGCCCTGGCTCAGGG - Intronic
1073665875 10:105533223-105533245 TAGCCCTGAGACCTGGAAGAGGG + Intergenic
1074534046 10:114315908-114315930 CAGCCCTGGGATCTGGCTGCTGG - Intronic
1075634199 10:124019277-124019299 CAGCCCTGAGACCGCCCTCAGGG + Intronic
1075671645 10:124267326-124267348 CAGGCCTGAGACTTGGGTGCAGG - Intergenic
1076408534 10:130230151-130230173 CAGGGCTGAGACGCGGCTGAGGG + Intergenic
1076424495 10:130358014-130358036 GAGCCCGGAGACATGACTGAGGG - Intergenic
1076737124 10:132463901-132463923 CTGCCCTGGGACCTGGGTGCTGG - Intergenic
1076893370 10:133296076-133296098 CTGACCTGAGAGCTGGCTGCAGG + Intronic
1077341020 11:2026359-2026381 GAGAACAGAGACCTGGCTGAGGG + Intergenic
1077414503 11:2418439-2418461 CACCCCTGGGACAGGGCTGAAGG - Intronic
1078191255 11:9093877-9093899 CACCCCTGAGGCCTGGTTCATGG - Intronic
1080695672 11:34601078-34601100 CAGGGCTGAGGCATGGCTGAAGG - Intergenic
1081702603 11:45161520-45161542 CAGCCGGGAAACCTGCCTGAAGG - Intronic
1084362747 11:68679642-68679664 CAGCCCAGGGACCAGGCTCAGGG + Intergenic
1084659560 11:70538847-70538869 CAGCCCTGAGTGCTGTCTCAGGG + Intronic
1084775301 11:71370844-71370866 CAGCCCCCAGCCCTGGCTGGAGG + Intergenic
1085047104 11:73360022-73360044 CAGCCCTGACATTTGCCTGAGGG + Intronic
1088974621 11:114804792-114804814 CAGACCTGAGATGTGGCTGGAGG + Intergenic
1089075838 11:115737789-115737811 CAGGCCTGAGATCTGGCCAATGG - Intergenic
1089645427 11:119875705-119875727 CAGCCCAGAGGCGGGGCTGATGG - Intergenic
1090064680 11:123492485-123492507 CAGCCCCCATACCTGGCAGATGG + Intergenic
1202824005 11_KI270721v1_random:81548-81570 GAGAACAGAGACCTGGCTGAGGG + Intergenic
1091398829 12:170711-170733 CAGCCCTGCAGACTGGCTGAGGG - Intronic
1092081575 12:5720788-5720810 GAGCCCTGAGGCCTGGGTTATGG - Intronic
1092279051 12:7085980-7086002 CAGCCCCGAAACCTGCCTAATGG - Exonic
1092679307 12:10960231-10960253 CAGTCCTGAGAACTGGCTGAGGG - Intronic
1092680988 12:10981067-10981089 CAGCCCTGAGAACTGGCTGAGGG - Intronic
1092681850 12:10992092-10992114 CAGTCCAGAGAACTGGCTAAGGG - Intronic
1096521119 12:52185335-52185357 CAGCCCTCAGGCCTTGCTCATGG + Intronic
1097918714 12:65048171-65048193 CTGCTCTGAGATCTGGCTTAAGG + Intergenic
1101225022 12:102679482-102679504 AAGTCCTGAGACGTGACTGAGGG + Intergenic
1101599208 12:106193988-106194010 TAGCACAGAGAGCTGGCTGATGG + Intergenic
1102471497 12:113162236-113162258 CAGCACTGGGGCCTGGCTCAGGG + Intronic
1103318686 12:120077487-120077509 CAGGCCTGAGAACTGGCTGAGGG - Intronic
1104185068 12:126422698-126422720 CAGCCTTCAGTCGTGGCTGAAGG + Intergenic
1104835294 12:131786416-131786438 CAGCTCTGTGGCCTGGCTGGCGG - Intronic
1104912872 12:132248066-132248088 CAGGCCTGAGCCCTGCCTGCTGG + Intronic
1105438992 13:20400264-20400286 AGGCCCTGAGGCCAGGCTGAAGG - Intergenic
1105744989 13:23369330-23369352 CAGCCCTGTCACTTGTCTGAAGG - Intronic
1106001605 13:25728697-25728719 CAGCCCTGTGACCTGGGACACGG - Intronic
1106438422 13:29744003-29744025 CAGCCCTGAGAGTTGGGTGCAGG - Intergenic
1107442692 13:40442420-40442442 CAGCCCTGGGGACTTGCTGATGG + Intergenic
1108760539 13:53557932-53557954 CAGCGCTGAGACCTAGCAGGTGG + Intergenic
1110643049 13:77848741-77848763 CAGCCCTTATACATTGCTGATGG - Intergenic
1112806412 13:103167826-103167848 CAGCCCTGTGTCCTGGTTGTAGG - Intergenic
1113827514 13:113268125-113268147 CAGCCCTGAGGCCTGGAGGTGGG + Intergenic
1113907324 13:113825927-113825949 CAGCCCTGAGATCTGACGGAGGG + Intronic
1114423166 14:22601656-22601678 CAGCCTTGAGACCTGGGAGGAGG - Exonic
1114426417 14:22627602-22627624 CAGACCTGATTCCTGTCTGAGGG - Intergenic
1114426433 14:22627715-22627737 CAGCCCTGAGGCTTGGAGGAGGG - Intergenic
1114563237 14:23608582-23608604 AGGCACTGAGACGTGGCTGAAGG - Intergenic
1118633817 14:67729328-67729350 CTGCACTGCGCCCTGGCTGAGGG + Exonic
1119185439 14:72638368-72638390 CAACCATGGGACCTGGCTAAAGG + Intronic
1119983754 14:79112382-79112404 CAGCCTTGAAGCCTGGCTGGCGG + Intronic
1121469809 14:94143979-94144001 AAGCCCTGGGCCCTGGATGAGGG - Intergenic
1122362614 14:101176323-101176345 CAGCCCAGGGACCTGGCCTAAGG - Intergenic
1123026160 14:105425211-105425233 CCACCCTGAGACCTGGTTGGGGG + Intronic
1123439056 15:20276893-20276915 AAGCCGGGATACCTGGCTGAGGG - Intergenic
1124389295 15:29239455-29239477 GAGATCTGACACCTGGCTGAGGG - Intronic
1125673891 15:41492630-41492652 CATTCCTGAGCCCTGGCTGAGGG + Intergenic
1125716816 15:41824044-41824066 CACACCTGAGTCCTGGCTCAGGG - Exonic
1126303915 15:47232457-47232479 CAGGCCTCACACCTTGCTGATGG - Intronic
1127335385 15:57979132-57979154 CAGACCTCAGACCTGCCTCAGGG - Intronic
1127469641 15:59279122-59279144 CATCCCTGAGACCTGACACAGGG + Intronic
1128300720 15:66564886-66564908 CAGCCCAGAGTCCTGGCTCTGGG - Intronic
1128664877 15:69530852-69530874 CAGCCCGAAGCCCTGGCTGATGG + Intergenic
1128666891 15:69544907-69544929 CAGCCATGTGACCTGGCACAGGG - Intergenic
1129238240 15:74236526-74236548 CAGCCCTGGGGCCTGGATGTGGG - Exonic
1129242318 15:74259018-74259040 CAGCCCTGAGACCAAGCTGCAGG - Intronic
1131442091 15:92467017-92467039 CAGCAGTGAGGGCTGGCTGAGGG - Exonic
1132029799 15:98430306-98430328 CAGCCCAGGGCCCTGCCTGAGGG + Intergenic
1132750659 16:1455937-1455959 CAGCCCTCAGACCTCCCTCAGGG - Intronic
1133267576 16:4594194-4594216 CAGGCCTGGGGCCTGGCGGATGG - Intronic
1134023381 16:10937298-10937320 CCGCCCTGACCCCTGGCTGTGGG + Intronic
1134085067 16:11350679-11350701 CAGCCCTGAGCCCTGCCTGCAGG + Exonic
1134125515 16:11613392-11613414 CAGCCCTGGGACCTGGCAGCTGG - Intronic
1134458334 16:14410853-14410875 GGGGCCGGAGACCTGGCTGAGGG + Intergenic
1135068271 16:19330034-19330056 CAGCTGTGAAATCTGGCTGATGG + Intergenic
1135348585 16:21710030-21710052 CCAACCTGAGACCTGGTTGAGGG - Exonic
1136501025 16:30669687-30669709 CAGCCCTAGGACCTGGTTAAAGG - Exonic
1137935701 16:52633442-52633464 GAGGCTTGAAACCTGGCTGATGG - Intergenic
1138079153 16:54072377-54072399 CAGCCCTGGGCGCTGGCTGCTGG - Intronic
1138354782 16:56368348-56368370 CAGCTCTTTGACCTGGCTGTTGG - Intronic
1138507733 16:57486505-57486527 CAGCGGCGAGACCTGGCGGAGGG - Intronic
1139374243 16:66486936-66486958 GAGCCCTCAGGCCTGGCTGGAGG - Intronic
1139689251 16:68629465-68629487 CAGCCCTCACACCTGTCTGTCGG + Intergenic
1139747965 16:69089647-69089669 CAGCCCTGAGCTCTGCCTGCAGG - Intergenic
1141102779 16:81210219-81210241 CAGCCCTGACACCTTGGTGTCGG - Intergenic
1141342859 16:83219099-83219121 CAGCACTGAGACCTGAATGGAGG - Intronic
1141587913 16:85047406-85047428 AAGCCCTGCCTCCTGGCTGAAGG - Intronic
1141643573 16:85355533-85355555 CCGCCCTCAGCCCTGGCTGTCGG - Intergenic
1142048973 16:87945763-87945785 CAGTCCTGAGACATGTCTGGGGG - Intergenic
1142140271 16:88469649-88469671 CCGGCCTGAGACCTGGCTGGAGG + Intronic
1143360277 17:6363814-6363836 GAGTACTGAGACCTGGCTGAGGG - Intergenic
1143637775 17:8176266-8176288 AAGCCCTGAGACCCGGCCCATGG + Exonic
1144189473 17:12831247-12831269 CAGCAGTGAGACTTGGCTGCCGG + Intronic
1144227171 17:13160448-13160470 CAGCCATGGGACCTGGCTCTGGG + Intergenic
1145962635 17:28896607-28896629 CAGCTGTGAGGCCTGGCTCAGGG + Intronic
1145965557 17:28914214-28914236 CAGGCCTTAGACCTTGATGAAGG - Intronic
1147200324 17:38797412-38797434 CTATCCTGAGACTTGGCTGAGGG + Intronic
1147583430 17:41639184-41639206 CTGCCCTGCAGCCTGGCTGAGGG + Intergenic
1148216827 17:45837893-45837915 CAGCCCTGAGACCAGGCATCTGG + Intergenic
1148647450 17:49227292-49227314 CATCTGTGAGACCTGGCTGGGGG - Intronic
1151144730 17:72030375-72030397 TAGCCCTGAGAGCTGACTGTAGG - Intergenic
1151566658 17:74902312-74902334 CAGCCCAGGGACCTGGCGGATGG - Intergenic
1151630775 17:75309417-75309439 CAGCCCTGAGGGCTGGGCGAGGG - Intergenic
1151769269 17:76149250-76149272 CTGCCAGGAGACCTGGCTGGTGG - Intronic
1152128155 17:78459791-78459813 CATCCCTGAGGCCTGCCTGAAGG - Exonic
1152709856 17:81865966-81865988 CAGCCCAAAGTCCTGGCTGCTGG + Intergenic
1153915581 18:9741668-9741690 CAGCCCTGAGATCCAGCCGAGGG - Intronic
1154980326 18:21498336-21498358 CAGCCCTAACCCCTGGCTGGGGG - Intronic
1156401443 18:36743797-36743819 GAGCCCTGGGACATGGCTCATGG + Intronic
1158438385 18:57451414-57451436 CAGCTCTGAGGCCTCCCTGAAGG + Intronic
1159995827 18:74962844-74962866 AAGGCCTGAGACTCGGCTGAGGG + Intronic
1160631993 18:80253390-80253412 CAGCCCTGACACATGCCTGGAGG - Intergenic
1160716914 19:580862-580884 CAGCCCTCAGGACTGGGTGAGGG + Intronic
1160716932 19:580908-580930 CAGCCCTCAGGACTGGGTGAGGG + Intronic
1160717009 19:581107-581129 CAGCCCTCAGGACTGGGTGAGGG + Intronic
1160717061 19:581245-581267 CAGCCCTCAGGACTGGGTGAGGG + Intronic
1161041428 19:2112760-2112782 CTGCCCTGGGACCTGGGTGGCGG + Intronic
1161383736 19:3980156-3980178 CTGCCCTGGGACCTGGCAGGAGG - Intronic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1161561850 19:4977753-4977775 CAGTCCTGAGTCCCGGCTGAGGG - Intronic
1161668209 19:5589785-5589807 CAGCCCTGAGTCCTGGGTGGAGG + Intronic
1161677649 19:5661458-5661480 CAGCCCTGGGACCTGGCTGGGGG + Intronic
1161960463 19:7520306-7520328 CAGCGCTGAGCTCTGGCCGAAGG - Exonic
1162473711 19:10887504-10887526 GCGCCCTGGGACCTGGCAGAGGG + Intronic
1162498203 19:11035199-11035221 CAGGCCTGAGTCCTGGCGGTGGG - Intronic
1162584879 19:11552514-11552536 GAGCCCAGAGTCCAGGCTGAGGG - Intronic
1163419338 19:17205515-17205537 CAGGCCTGGGCCCTGCCTGAGGG - Intronic
1163463656 19:17454392-17454414 TATTTCTGAGACCTGGCTGAGGG - Intronic
1163519732 19:17784789-17784811 CTCCACTGAGACCTGGGTGAGGG - Exonic
1163832230 19:19552594-19552616 TAACCCTGAGACATGGCTGCAGG - Intergenic
1163947334 19:20550983-20551005 CATTCCAGAGACCTGGATGAAGG + Intronic
1163988334 19:20973221-20973243 CTTCCCTGAGACCTGCATGATGG - Intergenic
1164908228 19:31985010-31985032 AAGGCCTGAGAGCTGGCTGTTGG - Intergenic
1164982960 19:32627997-32628019 CAGCAGAGAGGCCTGGCTGATGG - Intronic
1165035018 19:33026661-33026683 AAGCCAGGATACCTGGCTGAGGG - Intronic
1165198618 19:34127121-34127143 GGGCCCTCAGACCTGGCTGCTGG - Intergenic
1165895704 19:39139663-39139685 CAGCCCTGAGACCTGGATGGGGG - Intronic
1167461004 19:49624766-49624788 CAGATCTGAGACCTGGCTGTTGG + Intronic
1167483451 19:49746617-49746639 CAGCCCTGGGACGTGGCGGCGGG + Exonic
1167962725 19:53120482-53120504 CACCACTGAGACCTGTGTGAGGG + Intronic
1168586561 19:57598737-57598759 AAGGCCTGAGAACTGGGTGAGGG - Intergenic
925067168 2:937573-937595 CCTCCCTGAGACCCGGCTGCTGG + Intergenic
926243289 2:11104257-11104279 CAGACCTGAGACCTGAATGCTGG + Intergenic
927189847 2:20510090-20510112 CAGCCCTGAGAGCAGGGTGTGGG - Intergenic
927852560 2:26509393-26509415 CAGCCCAGAGACCTGAAGGATGG - Intronic
929571991 2:43028485-43028507 CAGCCCTCAGCCCGTGCTGAAGG + Intergenic
931943357 2:67277649-67277671 CAGCACTGCCACCTGGCTGATGG - Intergenic
933158535 2:78999929-78999951 CAGCCAGGAGCCCTGGGTGATGG - Intergenic
934713431 2:96529900-96529922 CAGCCATGGGGCCTGCCTGAGGG - Intergenic
935426679 2:102926268-102926290 AAGGCCTGACACCTGGCTGGTGG + Intergenic
935830941 2:107000135-107000157 CAGCCCTTTGCCCTGGCTGGTGG + Intergenic
936098236 2:109550759-109550781 CAGCCGAGAGCCCTGGTTGAGGG - Intronic
936281027 2:111139885-111139907 TAGCCCTGAGACAGGGCTGCTGG + Intronic
937046445 2:118854563-118854585 CAGCTCTGAGCCCTGATTGAGGG + Intergenic
937105794 2:119311554-119311576 CTATCCTGAGGCCTGGCTGATGG - Intronic
941766302 2:169300669-169300691 GAGCCCTGAAACCTGGAGGAAGG - Intronic
942074244 2:172342271-172342293 GAGCCCTGTGTCCTGGCAGAGGG - Intergenic
942077458 2:172369381-172369403 CAACCCTGATAGATGGCTGAGGG + Intergenic
942381725 2:175398723-175398745 CAGACCTGAGACCTAGTTGAAGG - Intergenic
944640028 2:201715342-201715364 CTGCACTGAGTTCTGGCTGAGGG + Intronic
946237009 2:218330275-218330297 CAGCCCTGAGAGAAGCCTGAAGG - Intronic
946336080 2:219037524-219037546 CAGCCTTGAGGCCTGTCTGGTGG + Intronic
947573237 2:231251642-231251664 CATAGCAGAGACCTGGCTGATGG + Intronic
948287658 2:236799022-236799044 CAGCCCTGACCCCTGGCTGTGGG + Intergenic
948487800 2:238291755-238291777 CACCTCTGTGAGCTGGCTGAGGG - Intergenic
948987322 2:241533379-241533401 CAGGCCTGGGAGCTGGGTGAGGG + Intergenic
1168846045 20:945294-945316 CAGCCCTGAGGAGTGGCTGACGG - Intergenic
1169067930 20:2705024-2705046 CTGGCCTGGGCCCTGGCTGAAGG - Intronic
1170016884 20:11791562-11791584 CTGCCCTGAGAGTTGGCTCATGG - Intergenic
1170653980 20:18268746-18268768 GAACACTGAGACCTGGGTGAAGG - Intergenic
1173054369 20:39597101-39597123 CTGCGCTAAGACTTGGCTGAGGG + Intergenic
1174170340 20:48613904-48613926 CAGCCCTGAGATCTGACAGCGGG - Intergenic
1175215519 20:57390113-57390135 CAGCCCTCTGCCCTGGCTGCCGG - Intergenic
1175426434 20:58870345-58870367 TAGCCCTGAGTGGTGGCTGAGGG + Intronic
1175918614 20:62439437-62439459 GAGTCCTGAGTCCTGGCTGGTGG - Intergenic
1175935941 20:62514112-62514134 CAGCTCCGAGGCCTGGCAGAGGG - Intergenic
1176296037 21:5073664-5073686 CTGTCCCGAGACGTGGCTGAAGG + Intergenic
1176385853 21:6138266-6138288 CAGCCCACAGGCCTGGCTGCTGG - Intergenic
1177631651 21:23736135-23736157 CAGTTCTGAGACCAGTCTGATGG - Intergenic
1178668023 21:34565941-34565963 CAGCCCCGACACCTGGTAGATGG - Intronic
1179729454 21:43359538-43359560 CAGCCCTGACTCCTGGGTGTTGG - Intergenic
1179737620 21:43399986-43400008 CAGCCCACAGGCCTGGCTGCTGG + Intergenic
1179861012 21:44188457-44188479 CTGTCCCGAGACGTGGCTGAAGG - Intergenic
1180030759 21:45205433-45205455 CGTCCCGGAGACCTGGCTCAGGG - Intronic
1180105880 21:45617732-45617754 CAGACCTGAGCGCTGGCTGCTGG - Intergenic
1180952819 22:19728386-19728408 CAGCCCTGAGCCCTGGCAGAAGG - Intergenic
1181160512 22:20957282-20957304 CAGCCCTGAGGCGGGGCTGAGGG + Intergenic
1181566901 22:23744340-23744362 CAGGCCTGAGCTCTGGTTGAAGG + Exonic
1181693124 22:24577114-24577136 CCTCCCAGAGACCTGGATGAAGG - Intronic
1183344620 22:37300547-37300569 GGGCCCTGAGATCTGGCTGTGGG - Intronic
1183589139 22:38769831-38769853 CGGCCCTCAGACCTGGAAGAAGG + Intronic
1184247999 22:43245357-43245379 CAATCCTGAGACCTGTCTGCTGG + Intronic
1184292773 22:43506976-43506998 CAGGGCTGGGACCTGGGTGAGGG - Exonic
1185069061 22:48646484-48646506 CTGCCCTGTGGCCTGGCTGCTGG + Intronic
950449739 3:13058936-13058958 CAGCCCACCCACCTGGCTGAGGG - Intronic
950475961 3:13214986-13215008 CAGCCCTGAACCATGTCTGAGGG - Intergenic
954155355 3:48682217-48682239 GGGCCCTGAGCCCTGGCTGTGGG + Intronic
956716786 3:72086482-72086504 CAGCACTGTGAAATGGCTGAAGG + Intergenic
959328900 3:104976814-104976836 CAGCACTAAGACCTACCTGAGGG + Intergenic
961402361 3:126656228-126656250 CAGCCCTGCGACCTCCCTGAGGG - Intergenic
961475270 3:127141996-127142018 CAGCCCCGCCTCCTGGCTGATGG + Intergenic
961496077 3:127292449-127292471 CAGCCCTCAGCCCTTGCAGATGG - Intergenic
963863098 3:150330794-150330816 CTGCCCTAAGAACTGGCTGTTGG + Intergenic
966860194 3:184227487-184227509 CAGATCTGAGGCCGGGCTGAGGG - Intronic
968515653 4:1014677-1014699 AGGCCCTGAGGCCTGGCTGGGGG - Intronic
968716447 4:2163435-2163457 GAGCACTGAGTGCTGGCTGAGGG + Intronic
968759953 4:2437503-2437525 CAGCCCTGAGACCCTGCACAGGG + Intronic
968895294 4:3397365-3397387 CAGAGCTGAGACCTGACAGATGG + Intronic
969333771 4:6494907-6494929 CTGCCCTGAGACCAGGATGGTGG + Intronic
969523781 4:7693858-7693880 AAGCCCTTGGGCCTGGCTGAGGG + Intronic
969588640 4:8108897-8108919 CGGCCTTGAGACCAGGCTGTGGG + Intronic
971824498 4:31603945-31603967 CAGCCTTCAGCCGTGGCTGAAGG + Intergenic
974117771 4:57601359-57601381 CAGCCTTGTGCCCTGACTGATGG - Intergenic
974374732 4:61061799-61061821 GAGCCCTCACACCTGGCTGGTGG - Intergenic
974847370 4:67367190-67367212 CAGGCCTAAGTTCTGGCTGATGG - Intergenic
977045548 4:92064671-92064693 CAGCCCTGTGATATGGCTCAAGG + Intergenic
978301210 4:107270784-107270806 GTCCCATGAGACCTGGCTGAAGG - Intronic
978561500 4:110038668-110038690 CAGAGCTGGGACCTGGATGAAGG + Intergenic
980208503 4:129754285-129754307 CAGGCCTGAGTCAAGGCTGAGGG + Intergenic
984634038 4:182091982-182092004 CAGTCCTGTGACCTGGCAGTTGG + Intergenic
984725237 4:183013810-183013832 CAGGCCTGAGAAGTGGCTTATGG - Intergenic
984912264 4:184685093-184685115 CAACACCAAGACCTGGCTGATGG + Intronic
985959398 5:3288500-3288522 CTTCCCTGAGTCCTGGCTGCTGG - Intergenic
986015450 5:3753431-3753453 CAGCCCAGACACCAGGCTGGGGG + Intergenic
986102871 5:4630292-4630314 CCGCTCTGAGAACTGGCTGGTGG + Intergenic
986758466 5:10858762-10858784 CATACCTGAGTCCTGGCTGGAGG - Intergenic
996227849 5:121023024-121023046 CAGCCCTTAGACCTGGATGGTGG - Intergenic
998061333 5:139121023-139121045 TGGGCCTGATACCTGGCTGAAGG + Exonic
999154911 5:149451128-149451150 CAGCTGTGAAACCTGGCTGTTGG + Intergenic
999373338 5:151069444-151069466 CAGGGCTGATACCTGCCTGATGG + Intronic
999404292 5:151293383-151293405 CTGCCCGAACACCTGGCTGAGGG - Exonic
1000101676 5:158022708-158022730 CTGCCCTCAGACATGGCAGAGGG - Intergenic
1000372803 5:160553466-160553488 TATCCCTGAGACATGGCTGTAGG - Intergenic
1001695908 5:173669627-173669649 CAGCCCTGAGAGTGGGCTGGGGG - Intergenic
1002074136 5:176698120-176698142 GAGACCTGAGCCCTGGCAGATGG + Intergenic
1002100622 5:176855815-176855837 CACCCCTGAGCCCTGGATGCTGG - Intronic
1002301437 5:178259555-178259577 CAGCCCTGAGCCCTCACTGCAGG - Intronic
1002898893 6:1394287-1394309 CTGCCCTGAGCCCTGGCTTCAGG - Intronic
1003053903 6:2802484-2802506 GGGGCCTGAGCCCTGGCTGACGG - Intergenic
1004458911 6:15817439-15817461 CAGCCCTTACACCTGGGTGGGGG + Intergenic
1005070859 6:21861166-21861188 CATCCATGACACCAGGCTGAAGG - Intergenic
1006338562 6:33433435-33433457 TGTCCCTGAGACCAGGCTGAAGG + Intronic
1006824398 6:36923738-36923760 CAGCCCTGTTTCCTGCCTGAAGG - Intronic
1007743170 6:44025100-44025122 CAGGCCTGAGGCCTGGTGGAGGG - Intergenic
1008439938 6:51521126-51521148 CATCCTTCAGACCAGGCTGAAGG - Intergenic
1011613586 6:89177685-89177707 CAGCCCAGATACCAGGCAGACGG - Exonic
1012412877 6:98979605-98979627 CAGCCCTGAGACCATGGGGATGG - Intergenic
1014036364 6:116770777-116770799 CAGCCCTGAGGCCAGGCATAGGG + Intergenic
1014391643 6:120872307-120872329 GAAGCCTGAGACGTGGCTGAGGG + Intergenic
1017887013 6:158607876-158607898 CAGTCCTGGAACTTGGCTGAAGG + Intronic
1018079619 6:160247589-160247611 AAGGCCTGAGAACTGGCAGAGGG + Intronic
1018403666 6:163453433-163453455 TAGTCCAGAGACCTGGCTAAAGG + Intronic
1019593730 7:1848655-1848677 CAGCGCTGAATCCTGGCAGATGG + Exonic
1020211801 7:6163530-6163552 CAGCCCTGAGCCCTCTCTGTAGG + Exonic
1021983013 7:26073071-26073093 CAGCCCTGAGATGTGGCTAAAGG - Intergenic
1022134855 7:27437549-27437571 CAGTTCTTAGATCTGGCTGAGGG + Intergenic
1022520707 7:31005228-31005250 CAGCCCCTGCACCTGGCTGAGGG + Intergenic
1024006178 7:45226105-45226127 CAGCCCTGAGTGCAGGATGAGGG - Intergenic
1024059083 7:45685131-45685153 CAGCCCTGGGTCCTGGCTTCTGG - Intronic
1024581440 7:50804089-50804111 ATGCCCTGACACCTGGCTCATGG + Intergenic
1026152738 7:67802134-67802156 CAGCCCCGAGCCATGGCAGAGGG + Intergenic
1027151651 7:75738236-75738258 CAGCTCTGAGGCCGGGCGGAAGG - Intronic
1028128582 7:87143930-87143952 CATCCCTGGCAACTGGCTGAAGG - Intergenic
1029467849 7:100737204-100737226 GAGCCAGGAGGCCTGGCTGAGGG + Intronic
1029665940 7:101995126-101995148 CAGCTCAGAAACCTGGCTGGGGG + Intronic
1032478450 7:132227889-132227911 CAGGACTGAGGCATGGCTGATGG + Intronic
1033227823 7:139575022-139575044 CAGCCCTGTGAGGTGGGTGAGGG + Intronic
1035028550 7:155842993-155843015 CAGACCTGAGACGTGGATGAAGG - Intergenic
1035259455 7:157652448-157652470 CAGCTCTGACACCTTGCTGATGG + Intronic
1035284532 7:157797707-157797729 GAGCCCTGAGACCATGGTGAGGG + Intronic
1035650495 8:1260571-1260593 CACCCCGGAGTCCTGGCTCAGGG + Intergenic
1035700932 8:1638929-1638951 CAGCCCAGAGAGCTGGGTCATGG + Intronic
1036690542 8:10941903-10941925 CAGCCCACAGGCCTGGCTGCTGG - Intronic
1037928482 8:22863773-22863795 GAGCGATGATACCTGGCTGAAGG + Intronic
1037996196 8:23354067-23354089 AAGCCCTGGAGCCTGGCTGATGG - Intronic
1039146991 8:34458643-34458665 CAGTCCTAAGACCTGGCATAGGG - Intergenic
1043436164 8:80238145-80238167 CTGCACTGTGAGCTGGCTGAAGG - Intergenic
1043724838 8:83597970-83597992 GATCCCTGAGGCCTAGCTGATGG + Intergenic
1048043766 8:130754477-130754499 CAGCCCTTAGACATTCCTGAGGG + Intergenic
1049214102 8:141399741-141399763 CAGGCCTGTGACCTGGGGGAGGG + Intronic
1049599248 8:143499374-143499396 GAGCCCTGGGGCCTGGCTGCTGG - Intronic
1049750277 8:144279815-144279837 CAGCCCTGAGCCCTGGGAGAGGG + Intronic
1049799465 8:144511051-144511073 CTGGCCGGAGGCCTGGCTGATGG + Exonic
1049858612 8:144881632-144881654 GAGCACTGAGTACTGGCTGAAGG + Exonic
1051067584 9:13123094-13123116 CGTCTCTGAGGCCTGGCTGAAGG + Intronic
1052119424 9:24692369-24692391 CTGCCCTGAGACCTAGCAAAAGG - Intergenic
1057253420 9:93522917-93522939 CAGCACTGAGACCTAGCTGTTGG + Intronic
1057545147 9:96014251-96014273 CAGCCCTGTGAACTAACTGAAGG - Intronic
1057865180 9:98674724-98674746 CAGCTCTGAGACCCAGCTAAGGG - Intronic
1058758526 9:108106107-108106129 CGGCCCTAAGACCTTTCTGATGG - Intergenic
1060580699 9:124743619-124743641 CAGCCTTGAAACCAGACTGAAGG + Intronic
1060600688 9:124875547-124875569 AAGCCCTTAGAGCTGGCTGGAGG - Intronic
1061706178 9:132455138-132455160 CAGGCCTGGGACCTTGTTGATGG + Intronic
1061895934 9:133647733-133647755 CGGCCCTGCCTCCTGGCTGAGGG + Intronic
1062569197 9:137176971-137176993 CAGCTCTGAGACGTGGCCAAGGG + Intronic
1062597341 9:137305232-137305254 CAGCCCAGACACCTGGTAGAAGG + Intergenic
1062694253 9:137865079-137865101 CAGCCACGAGGCCTGGCAGAGGG + Intronic
1186076601 X:5886509-5886531 CAGCCCTCATATCTGGCTGCTGG + Intronic
1187276318 X:17819113-17819135 CAGCCCTGAGGGCTGTCTGTGGG - Intronic
1187671070 X:21666360-21666382 CAGACCTCGGACCTGGCTGATGG + Intergenic
1191020715 X:55857738-55857760 CAGCCCTATGGCCTGGCTGGTGG - Intergenic
1196124438 X:112083321-112083343 CGGCCCAGAGCCCAGGCTGACGG - Intergenic
1197678997 X:129362448-129362470 CTCCCCTGAGACCTGGAGGAGGG + Intergenic
1197706138 X:129635982-129636004 CTGACCAGAGAGCTGGCTGAGGG + Intergenic
1200073451 X:153540024-153540046 AAGCTGTGAGCCCTGGCTGAGGG + Intronic
1200087913 X:153619050-153619072 ATGCCTTGAGACCTGGTTGAAGG + Intergenic