ID: 922572011

View in Genome Browser
Species Human (GRCh38)
Location 1:226639900-226639922
Sequence CAGTGGTAGGAAAGGCCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 189}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922572006_922572011 -9 Left 922572006 1:226639886-226639908 CCCAGGCGAGTGAACAGTGGTAG 0: 1
1: 0
2: 0
3: 9
4: 302
Right 922572011 1:226639900-226639922 CAGTGGTAGGAAAGGCCCGGAGG 0: 1
1: 0
2: 0
3: 16
4: 189
922571998_922572011 29 Left 922571998 1:226639848-226639870 CCCAGACACAGGAGAACGCAGAG 0: 1
1: 0
2: 2
3: 20
4: 248
Right 922572011 1:226639900-226639922 CAGTGGTAGGAAAGGCCCGGAGG 0: 1
1: 0
2: 0
3: 16
4: 189
922571999_922572011 28 Left 922571999 1:226639849-226639871 CCAGACACAGGAGAACGCAGAGG 0: 1
1: 0
2: 3
3: 22
4: 219
Right 922572011 1:226639900-226639922 CAGTGGTAGGAAAGGCCCGGAGG 0: 1
1: 0
2: 0
3: 16
4: 189
922572005_922572011 -8 Left 922572005 1:226639885-226639907 CCCCAGGCGAGTGAACAGTGGTA 0: 1
1: 0
2: 0
3: 9
4: 157
Right 922572011 1:226639900-226639922 CAGTGGTAGGAAAGGCCCGGAGG 0: 1
1: 0
2: 0
3: 16
4: 189
922572007_922572011 -10 Left 922572007 1:226639887-226639909 CCAGGCGAGTGAACAGTGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 206
Right 922572011 1:226639900-226639922 CAGTGGTAGGAAAGGCCCGGAGG 0: 1
1: 0
2: 0
3: 16
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922572011 Original CRISPR CAGTGGTAGGAAAGGCCCGG AGG Intronic
901740982 1:11341756-11341778 CAGTGATTGCAAAGGCCCTGAGG + Intergenic
901807257 1:11746489-11746511 CAGGGGAAGGCAAGGCCCAGTGG + Intronic
901872638 1:12147036-12147058 CAGTGGTGGAAGAGGCACGGTGG + Intergenic
902549159 1:17208941-17208963 CAGTGGTGGGGAAGGCTTGGGGG - Intronic
902593811 1:17494329-17494351 CAGTGCCAGGCAAGGCCCAGAGG + Intergenic
902626017 1:17676805-17676827 CAGTGGGTGCAAAGGCCTGGGGG - Intronic
903475118 1:23614132-23614154 AAGTGGTAGCAGAGGCCAGGTGG + Intronic
903555658 1:24191280-24191302 CAGTGTTTGAAAAGGCCAGGGGG - Intergenic
903587126 1:24424652-24424674 CAGTGGCAGGAAAGGCAATGGGG + Intronic
906625502 1:47321766-47321788 CAGTGGTAGGCCAGGCATGGTGG - Intergenic
906708595 1:47912883-47912905 CAGTGGGAAGAAAGGACCTGTGG + Intronic
907300575 1:53484138-53484160 CAGTGGTGGGAACGGCCCCGAGG + Intergenic
907524673 1:55047145-55047167 CAGTGGAAAGAAAGGCCTAGAGG - Intronic
907712672 1:56898822-56898844 CAGTGTTAGGAAAGCTCTGGAGG - Intronic
911095020 1:94047979-94048001 CAGTTGCAGGCAAGGCCAGGAGG - Intronic
914327166 1:146630534-146630556 CAGTGGTAGGAATGTCACAGTGG + Intergenic
915162898 1:153932483-153932505 CAGTGGGAGGCAAGGCTCTGGGG - Intronic
916045714 1:160998669-160998691 CAGTGGTAGGAAAGGGAGGGAGG + Exonic
916144182 1:161725351-161725373 CAGTGGGAGGCCAGGCCCGGTGG + Intronic
916168036 1:161980829-161980851 CTGTGGGAGGAAAGGACCTGAGG + Intergenic
920169425 1:204061533-204061555 CAGTGGAAGGCCAGGCACGGTGG - Intergenic
922572011 1:226639900-226639922 CAGTGGTAGGAAAGGCCCGGAGG + Intronic
923687967 1:236167016-236167038 CTGTGGGAGGAAAGGCCCCGAGG + Intronic
1063137240 10:3228589-3228611 CCGTGGTAGACAAGGCCAGGAGG + Intergenic
1064320038 10:14296429-14296451 CACTGGAAGGACAGGCCCAGAGG - Intronic
1065300823 10:24319607-24319629 AAGAGGTAGAAGAGGCCCGGGGG + Intronic
1065314255 10:24446936-24446958 CAGTGGTGGGAAAGGACGGACGG - Intronic
1065584447 10:27203923-27203945 CAGTGTTCTGAAAGGCACGGTGG - Intronic
1068814146 10:61291030-61291052 GAGTGGTAGGAGGGGCCCAGGGG + Intergenic
1068854801 10:61786448-61786470 TAATGGTATGAAAGGCCCTGGGG - Intergenic
1071500825 10:86203265-86203287 CAGTGGGAGGAGGGGCCCTGAGG + Intronic
1071576993 10:86734751-86734773 CAAAGGTAGGAAGGGCCCTGTGG - Exonic
1072992021 10:100205569-100205591 CAGAGGTAGGAAAGACTCAGAGG - Intronic
1073074342 10:100814418-100814440 CAGTGGTGGGAAGGGACTGGGGG - Intronic
1073308509 10:102522689-102522711 CAGTGCTAGGAAAGGACAGTGGG - Intronic
1074761603 10:116670654-116670676 TAGAGGTAGGGAAGGCCGGGAGG - Intergenic
1075450861 10:122551250-122551272 CAGTGGCAGGTAAGGCCCTGGGG - Intergenic
1075453156 10:122567474-122567496 CAGAGGGAGGAAAGGCCAGCTGG - Intronic
1077093408 11:789511-789533 CAGAGGTGGGAAGGGCCCTGGGG + Intronic
1077129815 11:965564-965586 CAGAGGTAGGAAGAGCCCAGAGG - Intronic
1077401019 11:2357475-2357497 CTGTGGTGGGAAAGGCCAAGTGG + Intergenic
1078702145 11:13696695-13696717 AAGTGGTAGGATATGCCAGGAGG - Intronic
1078723720 11:13908713-13908735 CTCTGGGAGGAAAGGCCCTGAGG + Intergenic
1078859669 11:15235461-15235483 CCGTGGAAGGATAGGCCCGGTGG + Intronic
1078904739 11:15673298-15673320 TAGTGGGAGGAAAGGCCCTTTGG + Intergenic
1078999390 11:16738640-16738662 CTGTGGCAGAGAAGGCCCGGAGG + Exonic
1079129413 11:17738611-17738633 CAGTGGGAGGAGAGGGCCAGGGG - Intronic
1079474837 11:20819315-20819337 CAGTGAGAGGAAAGGCTTGGTGG + Intronic
1079980048 11:27141311-27141333 CAGTTCTGGGAAAGGCCCAGTGG - Intergenic
1080134410 11:28837726-28837748 TAGTGGTAGGCCAGGCACGGTGG + Intergenic
1081612220 11:44569335-44569357 CAGTGGAAGGGGAAGCCCGGGGG - Intronic
1083356312 11:62068910-62068932 CAGTAGGAGCAAAGGCCCCGAGG + Intergenic
1086432275 11:86747424-86747446 CAGTTGTAGGAGAGACCCTGGGG + Intergenic
1091488778 12:915216-915238 AAGGGGCAGGAAAGGCCTGGAGG + Intronic
1091804183 12:3344063-3344085 CAGTGTGAGCAAAGGCCTGGCGG + Intergenic
1094488657 12:30945063-30945085 CAGTGTGAGCAAAGGCCTGGGGG - Intronic
1097625688 12:61997465-61997487 CAGTGGAAAGAGAGGCCCAGTGG + Intronic
1098230024 12:68363824-68363846 GGGTGGTTGGAAAGGACCGGTGG - Intergenic
1101853271 12:108421449-108421471 TTGTAGTAGGAAAGGCCCAGTGG - Intergenic
1102321013 12:111934289-111934311 CAGTGGGGGGAAATGCCCAGAGG - Intronic
1103995542 12:124827676-124827698 CAGTGGGTGCAAAGGCCCTGGGG - Intronic
1104878213 12:132051481-132051503 CAGTGATAGGTAAGGCCACGTGG + Intronic
1107880654 13:44829445-44829467 CAGTAGGAGGGAAGGCCCAGGGG - Intergenic
1108910838 13:55549862-55549884 AAGTTGTAGGAGAGGCCTGGTGG + Intergenic
1111993416 13:95139025-95139047 CCGTGGAAGGAGAGGCCCAGGGG - Intronic
1112272043 13:97976954-97976976 CAATGGCCGGAAAAGCCCGGGGG - Intronic
1112579679 13:100667821-100667843 CAGAGGCAGGCAAGGCCCAGAGG - Intronic
1114602607 14:23968935-23968957 CAGAGGTGGGAAAGGCCAGTGGG - Exonic
1114606975 14:24006064-24006086 CAGAGGTGGGAAAGGCCAGTGGG - Exonic
1114612284 14:24051032-24051054 CAGAGGTGGGAAAGGCCAGTGGG - Intergenic
1116848374 14:49885299-49885321 CAATGGTAATAAAGGCCAGGTGG - Intergenic
1118207932 14:63740557-63740579 CAGTGGTAAGAAAGGCAGGTGGG - Intergenic
1120853063 14:89188032-89188054 CAGTGGAAGGAAAGAACCCGGGG - Intronic
1125679303 15:41520868-41520890 CAGTGGCAGGAAGGGCCAGTCGG + Exonic
1127681184 15:61300254-61300276 CAGTGGTCGGCCAGGCACGGTGG + Intergenic
1128772744 15:70294638-70294660 CAGTAGTTGCAAAGGCCCTGGGG + Intergenic
1128835190 15:70803797-70803819 GAGTGGTAGGCCAGGCACGGTGG - Intergenic
1133212825 16:4272619-4272641 CAGTGGTAGGAAGGGGGTGGGGG + Intronic
1134240343 16:12501432-12501454 CAGTGGTAGGCCAGACGCGGTGG + Intronic
1134402326 16:13920962-13920984 GAGTGGTAGGAGAGGATCGGAGG + Intronic
1134667768 16:16031625-16031647 CAGTGTGTGCAAAGGCCCGGTGG - Intronic
1136565045 16:31064741-31064763 CAGTGTTTGGAAAAGCCCGTTGG - Intronic
1137563766 16:49520665-49520687 CAGTGGGAGGCAAGGCCAGCTGG - Intronic
1138079652 16:54077774-54077796 AAGAGGTAGGCAAGGCCTGGAGG + Intronic
1138302943 16:55947819-55947841 TAGTGGTAGGAAAGGTCAGCAGG + Intronic
1141013650 16:80427058-80427080 CAGTGGTGGGAAAGGGAGGGAGG - Intergenic
1141221142 16:82070325-82070347 CAGTGGTAGGAAGGGGCTGGAGG - Intronic
1141440225 16:84025337-84025359 CAGCAGTAGCAAAGGCCCTGAGG - Intronic
1141658627 16:85429694-85429716 CAGTGGGGGCAAAGGCCCTGGGG - Intergenic
1142145061 16:88489457-88489479 CAGAGGCAGGAAAGGCAGGGAGG + Intronic
1145081891 17:19901074-19901096 CAGTGTGAGTAAAGGCCCTGAGG - Intergenic
1145084364 17:19923811-19923833 CAGTGGTAGGCCAGGCGCAGTGG - Intronic
1146103847 17:30012536-30012558 CAGTGATAGGTAAGGCCATGTGG - Intronic
1147341573 17:39755798-39755820 CGGTGGAAGGACAAGCCCGGGGG + Intergenic
1150829305 17:68505008-68505030 CAGTGGTTGGACAGGCGTGGTGG + Intergenic
1152601399 17:81264045-81264067 CAGTGGCAGGACAAGCACGGGGG - Intronic
1157482448 18:48064209-48064231 CAGTGGTTGGAATGGCAAGGTGG - Intronic
1159931399 18:74316021-74316043 CAGGGGGAGGAAAGGGCGGGTGG - Exonic
1160372086 18:78381982-78382004 CAGTGGTAGGCCAGGCACGGCGG + Intergenic
1161271396 19:3391507-3391529 CAGTCGTAGGCCAGGCGCGGTGG + Intronic
1161449807 19:4338771-4338793 CACTGGAAGGAGAGGCCAGGCGG - Exonic
1162613023 19:11770874-11770896 CAGTGGTAGGCTAGGCGTGGTGG - Intronic
1162809660 19:13156129-13156151 CCGCGGAAGGAAGGGCCCGGCGG - Intergenic
1163480816 19:17555405-17555427 CAGTGGTAGGAGGCGCCTGGAGG + Intergenic
1164605607 19:29595859-29595881 CACAGCTAGGTAAGGCCCGGTGG + Intergenic
1165469935 19:35997371-35997393 CAGTGTGGGGAAAGGCCTGGAGG + Intergenic
1165655846 19:37531555-37531577 CAGTGGGAACAAAGGCCGGGGGG - Intronic
1166650926 19:44574630-44574652 GAGTGTAAGCAAAGGCCCGGTGG + Intergenic
1167312912 19:48747367-48747389 CAGTGGGAGGAGAGGACTGGGGG + Intergenic
927606380 2:24490907-24490929 CAGTGGGAGGAACGCCCCGAGGG + Intergenic
927735176 2:25514281-25514303 CAGTAGTTGCAAAGGCCCTGAGG + Intronic
929699175 2:44147182-44147204 CTGTGGTAGCAAATGCCCAGGGG - Intergenic
930424448 2:51194757-51194779 CACTGGTAGCAAAGGTCCGTGGG + Intergenic
932467175 2:71931413-71931435 CAGTGGCAGGCCAGGCGCGGTGG - Intergenic
932704092 2:74010027-74010049 CAGTGGGAGGAAAGGCCACAGGG - Intronic
936234408 2:110731237-110731259 TGGTGGTAGGAAAGCCCCAGGGG - Intergenic
944149147 2:196538781-196538803 CAGTGATAAGAAAGGCCAGCTGG + Intronic
946388913 2:219403999-219404021 CTGTGGTAAGAAATGCCCTGTGG + Intergenic
948214629 2:236219618-236219640 CAGTGGAAGAAATGGCCCAGTGG + Intronic
948374653 2:237513365-237513387 CACTGGAAGGGAAGGCACGGGGG - Intronic
948397450 2:237657057-237657079 CAGTGGTGGGAAAAGGCTGGCGG + Intronic
948803597 2:240443633-240443655 CAGTGGGAGGTGAGGCCCAGCGG + Intronic
1168956908 20:1840942-1840964 CAGTGAGTGCAAAGGCCCGGAGG + Intergenic
1172439426 20:34955351-34955373 CAGTGCCTGGAAAGGCCCCGAGG + Intronic
1173509132 20:43612403-43612425 CAGAGGGAGGCCAGGCCCGGTGG + Intronic
1175062143 20:56253208-56253230 CAGTGGTTGCAAAGGCCCTGGGG - Intergenic
1175678912 20:60970372-60970394 CAGTGGAAGGAAATGCACGAGGG - Intergenic
1176072316 20:63233780-63233802 AAGTGGAAGGAAAGGCCCTGGGG - Intergenic
1178202839 21:30427196-30427218 CAGTGTTGGGGAAGGCCTGGTGG + Intergenic
1178285666 21:31323418-31323440 CAGTGGTAGGCCAGGCGCAGTGG + Intronic
1178426514 21:32483158-32483180 CAGGGGTAGGAATGGCAGGGAGG - Intronic
1183293529 22:37017292-37017314 CTGTGGAAGGGAAGGCCAGGTGG - Intronic
1183303585 22:37070424-37070446 CAAGGGCAGGGAAGGCCCGGTGG - Intronic
1183542406 22:38437150-38437172 AAGTGGTTGGGAGGGCCCGGTGG - Intronic
1184209073 22:43024610-43024632 CAGTGGAAGGAAAGGTGCTGGGG + Intergenic
1184937593 22:47736338-47736360 AAGTGGTTGGAAGCGCCCGGGGG - Intergenic
950400114 3:12763348-12763370 AAGAGGTAGGAAACGCCCTGAGG - Intronic
952949676 3:38511666-38511688 CAATAGTAGGAAAGGCAGGGTGG + Intronic
953366504 3:42350099-42350121 ATGTGGTAGGAAAGGCTCTGGGG - Intergenic
953732938 3:45465455-45465477 CAGGGGTAGGAAGGGCACAGAGG + Intronic
954579571 3:51695946-51695968 AGGTGGGAGGGAAGGCCCGGAGG + Intronic
955119872 3:56047285-56047307 CAGTGGTATTAAAGGACCAGAGG - Intronic
956126384 3:66014845-66014867 CAGTGGGAGCAAAGGCCTGGAGG - Intronic
960180393 3:114568958-114568980 CAGGGGAAGGCAAGGCCAGGTGG - Intronic
961359263 3:126357047-126357069 CAGGGGTCGGACTGGCCCGGGGG - Intronic
963933452 3:151027980-151028002 AAGTGACAGGAAAGGCCTGGTGG - Intergenic
968426777 4:528982-529004 CAGTGGATGGCAGGGCCCGGGGG - Intronic
969335124 4:6503252-6503274 CAGTGGCTGCAAAGGCCCTGAGG - Intronic
975140863 4:70916854-70916876 CAGTGGTAGGCCAGGCGCAGTGG - Intronic
975757019 4:77580881-77580903 CAGTGAAAGGGAAGGCCAGGGGG - Intronic
981931131 4:150190348-150190370 CAGTGTGAGGAAAGGCATGGTGG + Intronic
982129247 4:152212499-152212521 CAGGGGTAGTCAAGGCCAGGAGG + Intergenic
985779495 5:1862757-1862779 TGATGGTAGGAAAGGCCAGGGGG - Intergenic
992091295 5:73319692-73319714 CTGTGGTATGAAAGGTCTGGTGG - Intergenic
994135989 5:96287240-96287262 CAGTGGAAGGAAAGGGGAGGGGG - Intergenic
998613072 5:143710555-143710577 CAGTGGAAGCAAAGACCCAGAGG + Intergenic
999147429 5:149405607-149405629 CAGTGGAAGGCAGGACCCGGTGG + Intergenic
1001070136 5:168579030-168579052 AAGTGGGAGGAAAGGCTAGGGGG + Intronic
1002863140 6:1097487-1097509 CAAAGGAAGGAAAGGCCCTGTGG + Intergenic
1006378504 6:33684709-33684731 GAGTGGAAGGGAGGGCCCGGGGG - Intronic
1006422368 6:33943184-33943206 TAGTGATAGGAAGGGCCAGGAGG + Intergenic
1008004317 6:46393849-46393871 CAGTGGCAGACAGGGCCCGGAGG - Intronic
1010101365 6:72112142-72112164 CAGGGGGAGGAAAGGCCAGGAGG - Intronic
1012896258 6:104953294-104953316 CAGTTTTAGGCATGGCCCGGTGG + Intergenic
1013217834 6:108046305-108046327 CATTGGTAGGCCAGGCACGGTGG - Intronic
1013654274 6:112228920-112228942 CAGTGGTAGGAAAGACCAGCTGG + Intronic
1014479710 6:121920853-121920875 CTGGGGTAGGAAAGGCCATGTGG - Intergenic
1016447424 6:144148294-144148316 CAGTGGATGTAAAGGCCCCGAGG - Intergenic
1018933858 6:168260645-168260667 CTGTGGAAGGAAATGCCCAGCGG - Intergenic
1019308780 7:348811-348833 CAGAGGGAAGAAAGGCCCAGGGG + Intergenic
1021021855 7:15609857-15609879 AAGTGGTAGGAAAGGCCACATGG - Intergenic
1022025557 7:26444664-26444686 CAGTGGGTGCAAAGGCCCTGAGG - Intergenic
1023841024 7:44097471-44097493 CAGTGGCTGGCAAGGCCCGTTGG + Intergenic
1023873823 7:44276399-44276421 CTGCAGTAGGAAAGCCCCGGAGG + Intronic
1027051465 7:75023998-75024020 CAGTGGGAGGCCAGGCACGGTGG + Intronic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1028288995 7:89041595-89041617 CAGTGTTAGGCAAGGCCCCGTGG - Intronic
1029238414 7:99142749-99142771 AAGTGGTGGGAAAGACCAGGAGG + Intronic
1030227335 7:107168494-107168516 AAGTGTTAGCAGAGGCCCGGAGG + Intergenic
1032038599 7:128538981-128539003 AAGAGGTAGGACAGGCCAGGCGG - Intergenic
1035126070 7:156608264-156608286 CAGTGGGAGGAACGGCCTGGAGG - Intergenic
1037057058 8:14456119-14456141 CAGAGGTAGGACACGCACGGTGG + Intronic
1037576036 8:20203863-20203885 CAATGGAAAGAAAGGCCAGGGGG - Intronic
1042202934 8:66299376-66299398 CAGAGGTGGGAAAGGACAGGAGG + Intergenic
1042844378 8:73155753-73155775 AAGGGGGAGGAAAGGCCAGGTGG + Intergenic
1047816808 8:128473705-128473727 CAGTGGTATGAGAGGCCCAGGGG - Intergenic
1048872612 8:138811920-138811942 CACTGGAAGGAAAGCCCAGGAGG + Exonic
1048982942 8:139712861-139712883 CAGCGGATGGAAAGGCCCTGAGG + Intergenic
1048992400 8:139768413-139768435 CAGTGGTGGGCCAGGCCCTGCGG + Intronic
1048992579 8:139770015-139770037 CAGTGGTGGGCCAGGCCCTGTGG + Intronic
1049495097 8:142926357-142926379 CAGGGGCAGGAAGGGCCCTGGGG - Intergenic
1051669141 9:19493151-19493173 CAGGGATAGGGAAGGCCCAGGGG - Intergenic
1052485083 9:29087118-29087140 CATTGGTAGGCCAGGGCCGGTGG - Intergenic
1056753393 9:89367641-89367663 CAGTGACAGGAAGGGCCAGGGGG - Intronic
1056900749 9:90597211-90597233 CAGTGGGAGGAAAGGCAAAGGGG - Intergenic
1057149367 9:92782731-92782753 CTATGGTGGGAAAGGCCAGGTGG + Intergenic
1057199420 9:93132426-93132448 CAGTGGGAGCAAAGGCTCAGAGG - Intronic
1057773243 9:97984710-97984732 CAGTGGGAGCCAAGCCCCGGCGG - Intronic
1059399829 9:114061955-114061977 CAGTGGGAGCAAAGGCAGGGTGG - Intronic
1060102777 9:120855518-120855540 CAGTGGTAGGAGTGGCAAGGTGG + Intergenic
1060725598 9:126003711-126003733 CAGTGATGGGAAAGCCCAGGAGG + Intergenic
1061310699 9:129760366-129760388 CAGTGGTCAGAAAAGCCTGGAGG + Intergenic
1186469905 X:9813172-9813194 CTATGGTGGGAAAGGCCCAGTGG - Intronic
1189161109 X:38809891-38809913 CAGAGGGAGGAAGGGACCGGGGG - Intergenic
1192246785 X:69379407-69379429 CAGGGTTAGAAAAGGCCTGGAGG + Intergenic
1199594230 X:149493956-149493978 CAGGGGTGGCAAAGGCCTGGAGG + Intronic