ID: 922575422

View in Genome Browser
Species Human (GRCh38)
Location 1:226658209-226658231
Sequence ACCAGGCTTTTCCCCAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 177}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922575422_922575426 3 Left 922575422 1:226658209-226658231 CCTTCACTGGGGAAAAGCCTGGT 0: 1
1: 0
2: 0
3: 14
4: 177
Right 922575426 1:226658235-226658257 TCTCCTAGGCTGCAGAGTGGAGG 0: 1
1: 0
2: 8
3: 295
4: 3809
922575422_922575425 0 Left 922575422 1:226658209-226658231 CCTTCACTGGGGAAAAGCCTGGT 0: 1
1: 0
2: 0
3: 14
4: 177
Right 922575425 1:226658232-226658254 GCTTCTCCTAGGCTGCAGAGTGG 0: 1
1: 0
2: 1
3: 27
4: 204
922575422_922575429 9 Left 922575422 1:226658209-226658231 CCTTCACTGGGGAAAAGCCTGGT 0: 1
1: 0
2: 0
3: 14
4: 177
Right 922575429 1:226658241-226658263 AGGCTGCAGAGTGGAGGCGGTGG 0: 1
1: 0
2: 7
3: 83
4: 594
922575422_922575428 6 Left 922575422 1:226658209-226658231 CCTTCACTGGGGAAAAGCCTGGT 0: 1
1: 0
2: 0
3: 14
4: 177
Right 922575428 1:226658238-226658260 CCTAGGCTGCAGAGTGGAGGCGG 0: 1
1: 0
2: 5
3: 90
4: 699

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922575422 Original CRISPR ACCAGGCTTTTCCCCAGTGA AGG (reversed) Intronic
901091468 1:6644483-6644505 ACCAGGCTTTACCCAAGTTAAGG - Intronic
901198459 1:7453464-7453486 TCCAGGCCTTTCCACAGAGAAGG + Intronic
902262710 1:15238753-15238775 ACCAGACTTCTCCCCAGCAAAGG - Intergenic
902540730 1:17152652-17152674 ACTAGGCTGTGCCCCAGTTAGGG - Intergenic
902919091 1:19656000-19656022 ACCAGGGTGTGCCCCAGTCAGGG - Intronic
903303671 1:22397166-22397188 AACAAGTTTTCCCCCAGTGAGGG + Intergenic
905629037 1:39508613-39508635 ACCCAGATTTTCCCCTGTGAAGG - Intronic
907615349 1:55918787-55918809 TCCAGGTTTCTCCCCAGTGGAGG - Intergenic
909759788 1:79272266-79272288 ACCTGGCGTATCACCAGTGAAGG - Intergenic
912068687 1:105779801-105779823 ACCAGGCAGTGCCCCAGTGAGGG - Intergenic
914242348 1:145860125-145860147 CCCAGGCTTTGCCCTAGGGAGGG - Intergenic
915786993 1:158624222-158624244 ACTAGGCAGTACCCCAGTGAGGG - Intronic
918582961 1:186153804-186153826 ACCCGGCTGTTCACCATTGATGG + Exonic
919585721 1:199437043-199437065 TACAGGCTTCACCCCAGTGATGG - Intergenic
920336115 1:205246516-205246538 AACAGACTTCTCCCCAGTGGAGG - Intronic
922575422 1:226658209-226658231 ACCAGGCTTTTCCCCAGTGAAGG - Intronic
922852413 1:228744817-228744839 GCCACGCTTTTCCCCATTAATGG - Exonic
923857729 1:237863134-237863156 ACCAGAACTTTCTCCAGTGATGG + Intergenic
1064445236 10:15387150-15387172 ACAAGGCCTGTCCCCAGGGAAGG - Intergenic
1065679614 10:28215361-28215383 ACAAGTTTTTTCCCCAGTGTAGG + Intronic
1066975518 10:42364909-42364931 ACTATGCTATGCCCCAGTGAGGG + Intergenic
1068005022 10:51382975-51382997 ACAAGGCATTTCCCTAGAGAGGG - Intronic
1070371914 10:75790723-75790745 ACCAGTCTATTCCCCAGTGGAGG + Intronic
1070779026 10:79126900-79126922 CCAAGGCTTCTCCCCAGTGGAGG + Intronic
1070808671 10:79286300-79286322 ACCAGGCATTCCCCCGGTGGTGG + Intronic
1073780549 10:106833708-106833730 ATCAGGCTGCTCCCCAGTGGGGG + Intronic
1074516875 10:114178648-114178670 ACGTGGCTTTTTCACAGTGAGGG + Intergenic
1074657991 10:115616951-115616973 ACTAGGCAGTGCCCCAGTGAGGG - Intronic
1076913439 10:133404042-133404064 AACAGACATTTCCCCAGAGAGGG - Intronic
1077413408 11:2413792-2413814 CCCAATCTTTTCCCTAGTGAAGG - Intronic
1080725125 11:34890819-34890841 ACCAGGCTTTTATCCTGTTAGGG + Intronic
1081658807 11:44875214-44875236 ACCAGGCTTTTCCAGAGAGCTGG + Intronic
1084732699 11:71083635-71083657 GCCAGGCTTTGCCCCAAGGAAGG + Intronic
1087675656 11:101158410-101158432 ACCAGGCTGTGCTCCAGTGGGGG - Intergenic
1088472419 11:110200463-110200485 ACCAGTATTCTCCCCAGTCAGGG - Intronic
1089141502 11:116288450-116288472 CCCAGACTTGGCCCCAGTGATGG - Intergenic
1089705145 11:120272377-120272399 CCCAGGCCTCTCCCCAGGGATGG - Intronic
1089709350 11:120303714-120303736 AGGAGTCTTTCCCCCAGTGAAGG - Intronic
1092871800 12:12812244-12812266 ACTATGCATTTTCCCAGTGACGG + Intronic
1094719341 12:33047405-33047427 ACCAGGCATTACAGCAGTGAGGG - Intergenic
1101052110 12:100874246-100874268 ACAAGGCAGTGCCCCAGTGAAGG - Intronic
1106312007 13:28562912-28562934 ACCAGGCCCTTCCCCTGGGAGGG + Intergenic
1108509347 13:51140832-51140854 ACCAGTTTTTTACCTAGTGATGG - Intergenic
1109362990 13:61321084-61321106 ACCAGGCTTTAACTCAGTAAAGG + Intergenic
1112125080 13:96456677-96456699 AACATGTTTCTCCCCAGTGATGG + Intronic
1112820743 13:103332099-103332121 AGCAGGCTTTGGACCAGTGATGG + Intergenic
1114954945 14:27805760-27805782 TGCAGGCTTATCCCCAGTGGGGG - Intergenic
1115260981 14:31453627-31453649 ACCAGCCTTTTCTCAAGTAAGGG + Intronic
1115299136 14:31865025-31865047 ACCTTCCGTTTCCCCAGTGAGGG - Intergenic
1116098875 14:40408260-40408282 ACTAGGCAGTGCCCCAGTGAGGG + Intergenic
1118836304 14:69480394-69480416 TCCAGGCTTGTGCCAAGTGAAGG - Intergenic
1120503499 14:85325646-85325668 CCCAAGCTATTCCCCAGTAAAGG + Intergenic
1121624334 14:95373429-95373451 CCCAGGCTATGCCCCGGTGAAGG + Intergenic
1122948974 14:105030275-105030297 CCCAGGCTGCTCCCAAGTGAAGG - Intergenic
1124219489 15:27837125-27837147 ACCATGTTTCTGCCCAGTGAGGG + Intronic
1126740051 15:51768398-51768420 ACCTTTCTTTTCTCCAGTGAAGG - Exonic
1129801788 15:78420475-78420497 AAAAGGTTTTTCCCCATTGAGGG - Intergenic
1131287090 15:91069167-91069189 AGCCTGCTTTTCCCCAGTGGAGG + Intergenic
1131368084 15:91856192-91856214 ACCAGGCTTTCCATCAGCGAAGG - Intronic
1132261812 15:100432402-100432424 ACCAGACAATTCCCCAGTGGAGG + Intronic
1133573032 16:7060785-7060807 ACCAGACTTTTCTTAAGTGAGGG - Intronic
1133722927 16:8511811-8511833 CCCAGGTTTTTCACCAGAGAGGG - Intergenic
1139163640 16:64540203-64540225 ACTATGCATTTCCCTAGTGAGGG - Intergenic
1139882494 16:70187069-70187091 ACCAGACTCTGCCTCAGTGAGGG + Exonic
1140370015 16:74408435-74408457 ACCAGACTCTGCCTCAGTGAGGG - Intronic
1143775902 17:9198589-9198611 ACCAGGTTTTTCTACAGTGTAGG - Intronic
1144624427 17:16837596-16837618 CCCAGGCTCTGCCCCTGTGATGG + Intergenic
1144882000 17:18435124-18435146 CCCAGGCTCTGCCCCTGTGACGG - Intergenic
1145150233 17:20509262-20509284 CCCAGGCTCTGCCCCTGTGACGG + Intergenic
1146947635 17:36884796-36884818 ACCAGGCTCCCCCCCAGAGACGG + Intergenic
1147578561 17:41616317-41616339 CCCAGGCTCTGCCCCTGTGACGG + Intergenic
1147740237 17:42667238-42667260 CCTAAGCTTTGCCCCAGTGAGGG + Intergenic
1147854621 17:43469724-43469746 TCCAGCTTTTTCCCCAGAGAGGG + Intergenic
1159613749 18:70555399-70555421 ACTAGGATTTTCCCCACTGGCGG + Intergenic
1160309528 18:77776335-77776357 GCCAGGCTTTTCCTCAGAGCTGG + Intergenic
1160910466 19:1471545-1471567 ACGAGGCGTTGCCCCAGTCACGG - Exonic
1161667214 19:5584567-5584589 GCCAGACTTTTCCACAGTGGTGG - Intergenic
1161758203 19:6150244-6150266 GCCAGACTTTTCCACAGTGGCGG - Intronic
1163197663 19:15734986-15735008 ACCTGCCTTCTCCCCAGTTAGGG + Intergenic
1164465596 19:28484967-28484989 ATCAGGGTTTTCCCCTGCGAGGG - Intergenic
1166607747 19:44160167-44160189 ACCATGCTTTTCCCTATTGCTGG + Exonic
1167779313 19:51587426-51587448 AAAAGGCTTTTCCACAGTCATGG - Exonic
1168550800 19:57291695-57291717 AAAAGGCTTTTCTCCAGTGTGGG - Exonic
926625345 2:15085740-15085762 ACCTGGCTTCTCCCCACTGTGGG + Intergenic
927253732 2:21021330-21021352 ACCTGGCTTTTCTCCACTGCAGG + Intronic
928142182 2:28739393-28739415 CCCAGGCTACTCCACAGTGATGG - Intergenic
932370824 2:71186147-71186169 TCCCAGCCTTTCCCCAGTGAAGG + Exonic
935175853 2:100648205-100648227 AGCAGGCGGGTCCCCAGTGAGGG + Intergenic
935390750 2:102550302-102550324 AACTGACTTTTCCCCAGTGCTGG - Intergenic
935823448 2:106917040-106917062 ACCAGACTTTTCAGGAGTGAAGG + Intergenic
936275263 2:111090663-111090685 CCCAGGCTGTTCCCAAATGATGG - Intronic
937829045 2:126399954-126399976 ACCTTCCATTTCCCCAGTGAAGG + Intergenic
937880362 2:126859814-126859836 AACAGGCTTTTCCTCTGTGCAGG + Intergenic
939175602 2:138744359-138744381 ACAAGGCTTTTCCAGAGGGAGGG + Intronic
939191005 2:138916749-138916771 ACCATGCTTTTCATCACTGAAGG + Intergenic
942231725 2:173866735-173866757 ACCAGGTATTTCCCCTGTAAAGG + Intergenic
942839014 2:180337080-180337102 ACTAGGCTTTTCTCCTGTGGAGG + Intergenic
944545025 2:200790600-200790622 AGCAAGCTTTTCCCCAATGATGG - Intergenic
945500436 2:210566258-210566280 CCCTCCCTTTTCCCCAGTGATGG - Intronic
947638503 2:231693051-231693073 ACCAGGCCTGCCCCCAGTGGCGG + Intergenic
947948658 2:234128694-234128716 ACCAGACTCTTCCCCAGTCAAGG - Intergenic
948490110 2:238307261-238307283 AACAGGCATCTCCACAGTGAAGG - Intergenic
1168799529 20:635331-635353 ACCTGGGTTTTCCCTTGTGATGG + Intergenic
1170408700 20:16065977-16065999 CCCTGGCTTCTCACCAGTGAGGG + Intergenic
1171780737 20:29415572-29415594 ACCAAGCTTTTTCGAAGTGATGG + Intergenic
1172330800 20:34074904-34074926 ATGGGGCTTTTGCCCAGTGATGG + Intronic
1172947540 20:38700945-38700967 TCCAGCCTTTCCCCCAGTGCTGG + Intergenic
1173883996 20:46440711-46440733 ACCAACCATTTGCCCAGTGAAGG - Intergenic
1175188717 20:57197338-57197360 ACCTGGCTTTTCACCTGGGAAGG - Intronic
1175923176 20:62459371-62459393 ACCAGGCCCTTCCCCACTGTGGG + Intergenic
1175994917 20:62807733-62807755 ACCAGGCTGTGCCCCAGGCAGGG - Intronic
1177834766 21:26175783-26175805 AAAATTCTTTTCCCCAGTGATGG + Intergenic
1178796834 21:35752672-35752694 ACCAGGCTTATCCCCAGAAAGGG + Intronic
1178903339 21:36615354-36615376 ACTAGGCATTGCCCTAGTGAAGG + Intergenic
1181024752 22:20121750-20121772 CCCAGGCTGGTCCCCACTGAGGG + Intronic
1181429826 22:22872359-22872381 ACCAGGCTCTGCCCCAGGAAAGG + Intronic
1182476222 22:30577932-30577954 ACCTGGCCTGTCCCCTGTGATGG - Intronic
1182987566 22:34734876-34734898 AGCAAGCTTCTCCTCAGTGATGG + Intergenic
1184767496 22:46579196-46579218 ACCTGGTTCTTTCCCAGTGAAGG - Intronic
1185117794 22:48947814-48947836 TCCAGACTTTTCCCCTTTGAGGG - Intergenic
950112518 3:10428549-10428571 ACCAGGTGTTGGCCCAGTGAGGG - Intronic
950153686 3:10707501-10707523 ACCTGGCTTCTCCTCAGTGTGGG - Intronic
952589382 3:34932464-34932486 ACCAGGCAGTGCCCCAGTGGGGG - Intergenic
952932722 3:38372716-38372738 ACCTGGGTTGTCCCCAGTGAAGG - Exonic
953616967 3:44499796-44499818 ATAAGGCTTCTCCCCAGTGTGGG + Exonic
954079946 3:48207743-48207765 GCCCGGCTTGTCCCCAGTGGAGG - Intergenic
956779631 3:72593804-72593826 ACTAGGTCTTTACCCAGTGATGG + Intergenic
957084271 3:75665700-75665722 ACCAAGCTTTTTCGAAGTGACGG - Exonic
957862366 3:85971313-85971335 ACCAAGTTTTTAACCAGTGATGG - Intronic
959875077 3:111373057-111373079 ACCTTTCATTTCCCCAGTGAGGG - Intronic
960951900 3:123004716-123004738 ACCAGGCTCCTCCACACTGATGG + Intronic
961253186 3:125523636-125523658 CGCAGGCTCTCCCCCAGTGAGGG - Intergenic
961558054 3:127710128-127710150 GACAGGCTTTCCCCCAGTGAAGG - Intronic
961704230 3:128772156-128772178 AACTGGCTTTTCCACAGGGAAGG + Intronic
962068662 3:132010601-132010623 GCCAGGCATAACCCCAGTGATGG + Intronic
963146602 3:142001081-142001103 ACCAAGCTTTGCCCTGGTGAGGG + Intronic
963829477 3:149991754-149991776 AACAGACTTCTCCCCAGTGTAGG + Intronic
966668461 3:182499565-182499587 ACAAGGCCATTCTCCAGTGAGGG + Intergenic
968039681 3:195578716-195578738 ACCAGGCTTCTCAGCAGTGCAGG - Intronic
968356483 3:198111548-198111570 ACCAAGCTTTTTCCAAGTGCCGG - Intergenic
968685887 4:1958339-1958361 ACCAGGCTGTTGCCAAGTGCTGG + Intronic
968864573 4:3199761-3199783 ACTAGGCTGTTCCGCAGTGATGG + Exonic
969217217 4:5732002-5732024 ATGAGGATTTTGCCCAGTGAGGG + Intronic
973067351 4:45812565-45812587 ACCAGGCTTTTCACAGATGAGGG + Intergenic
979969535 4:127116727-127116749 ACCATGCTTTTCTCCAGTTTTGG + Intergenic
981472347 4:145150905-145150927 ACAAGTCTTTTCCCCTTTGAAGG - Exonic
982240004 4:153290417-153290439 CCAAGGGATTTCCCCAGTGAGGG - Intronic
987563468 5:19554702-19554724 ACCAGGCTTAGCCCCAGGAAGGG - Intronic
988068446 5:26253998-26254020 AGGTGTCTTTTCCCCAGTGAAGG + Intergenic
989146199 5:38252464-38252486 ACCAGTCTCTTCTCCAATGATGG + Intergenic
993631800 5:90294825-90294847 ACCAGCCCTTTCGCCACTGAGGG + Intergenic
998643359 5:144036737-144036759 ACAAAGCTTTTCCCCAGTGCTGG + Intergenic
1003150279 6:3542362-3542384 ACCAAGCTGATCCCCACTGAGGG + Intergenic
1003333494 6:5149245-5149267 AGCAGGCTTTTCCCACGTGTCGG - Intronic
1006093660 6:31642868-31642890 ACCAGGCATCGCCACAGTGATGG + Exonic
1006887795 6:37396926-37396948 ACCAGGCATTTCTCCAGGGCTGG + Intergenic
1008601562 6:53101188-53101210 GCCAGTCATTTCCCCAGTGATGG + Intergenic
1012511869 6:100011628-100011650 ATCAGGGTTTTCCCTAGAGATGG - Intergenic
1015029256 6:128574571-128574593 GCCAGGGGATTCCCCAGTGAAGG + Intergenic
1018242605 6:161793107-161793129 AGCAGGCTCCTCTCCAGTGAGGG - Intronic
1020210418 7:6154350-6154372 CCCAGGCCCTTCCCCAGCGAAGG + Exonic
1028741858 7:94284589-94284611 CAGAGGCTTTTCCCCAGAGAAGG - Intergenic
1028966287 7:96805405-96805427 ACAAGGCTTTTCCCAACTAATGG + Intergenic
1031522968 7:122788880-122788902 AGCAGGCCTTTCCTCAGTGCTGG - Intronic
1031950182 7:127883929-127883951 ACCAGGCTTCTCCACTGTAAAGG + Intronic
1032197064 7:129795435-129795457 GCCAGGCCTTGCCCCAGTGTGGG - Intergenic
1034670153 7:152851733-152851755 AGAAGACTTTCCCCCAGTGATGG + Intronic
1038918717 8:32057339-32057361 ACCAGGCCTTTCACCAGTGTAGG - Intronic
1039172945 8:34769378-34769400 ACCAGACTTTGCCCTAGTCAGGG + Intergenic
1039362767 8:36898005-36898027 CACAGGCTTTCCTCCAGTGATGG + Intronic
1039900708 8:41750461-41750483 ACAAGGCTTTTACAAAGTGATGG + Intronic
1042928616 8:73991991-73992013 ACCAGGCTTTCATCCAGTGAGGG - Intronic
1045187461 8:99853600-99853622 CACAGGCTCTTCCCCAGGGAGGG - Exonic
1046058450 8:109107238-109107260 ACTACACCTTTCCCCAGTGATGG + Intronic
1046496808 8:115024789-115024811 AACTGGCTATTTCCCAGTGAAGG + Intergenic
1046628681 8:116602307-116602329 ACCAGACTTTTCGTCAGAGAGGG + Intergenic
1049206016 8:141363929-141363951 CCCAGCCTTTTCCCCACAGAGGG + Intronic
1050328049 9:4516665-4516687 ACCAGGCTTTTCTCCAATCTAGG + Intronic
1051166157 9:14264323-14264345 ACCATTCTTTTCCCCATGGAAGG + Intronic
1052356946 9:27514681-27514703 ACCATGCTTTTCCCCATTTTGGG + Intronic
1052422519 9:28261725-28261747 ACCATGCAATTGCCCAGTGAAGG + Intronic
1057854711 9:98593597-98593619 ACCAGCCTTGTGCCCAGTGCTGG - Intronic
1058102034 9:100927018-100927040 AGCAGCCATGTCCCCAGTGAGGG + Intergenic
1058751783 9:108046176-108046198 ACCAAGCTTTGGCCCAATGAGGG - Intergenic
1058789914 9:108433993-108434015 AGCATGACTTTCCCCAGTGATGG - Intergenic
1060514768 9:124258638-124258660 ACCAGGCCTTTGCACAGTGATGG + Intronic
1185788828 X:2913055-2913077 ACCAAGCTTTGCCCCAGCCACGG - Intronic
1187390563 X:18884041-18884063 GACAGGCTTCTCCCAAGTGAGGG + Intergenic
1192713556 X:73616474-73616496 ACTAGGCAGTGCCCCAGTGAGGG + Intronic
1193764218 X:85506328-85506350 AGCAGGTTCTTCTCCAGTGATGG + Intergenic
1196893839 X:120314019-120314041 AGCAGTCTTCTCCCCAGAGATGG + Intergenic
1201372316 Y:13278801-13278823 ATCAGGCTTCTCCCCAGCCAAGG - Intronic