ID: 922576741

View in Genome Browser
Species Human (GRCh38)
Location 1:226665868-226665890
Sequence GAAGCACCTGTGGTGGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 358}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922576735_922576741 3 Left 922576735 1:226665842-226665864 CCAGGTGAGGCGAGGAGACACTC 0: 1
1: 0
2: 0
3: 7
4: 119
Right 922576741 1:226665868-226665890 GAAGCACCTGTGGTGGGGCCAGG 0: 1
1: 0
2: 1
3: 43
4: 358
922576732_922576741 9 Left 922576732 1:226665836-226665858 CCCAGCCCAGGTGAGGCGAGGAG 0: 1
1: 0
2: 2
3: 26
4: 260
Right 922576741 1:226665868-226665890 GAAGCACCTGTGGTGGGGCCAGG 0: 1
1: 0
2: 1
3: 43
4: 358
922576734_922576741 4 Left 922576734 1:226665841-226665863 CCCAGGTGAGGCGAGGAGACACT 0: 1
1: 0
2: 0
3: 10
4: 141
Right 922576741 1:226665868-226665890 GAAGCACCTGTGGTGGGGCCAGG 0: 1
1: 0
2: 1
3: 43
4: 358
922576733_922576741 8 Left 922576733 1:226665837-226665859 CCAGCCCAGGTGAGGCGAGGAGA 0: 1
1: 0
2: 1
3: 29
4: 253
Right 922576741 1:226665868-226665890 GAAGCACCTGTGGTGGGGCCAGG 0: 1
1: 0
2: 1
3: 43
4: 358
922576730_922576741 15 Left 922576730 1:226665830-226665852 CCACGGCCCAGCCCAGGTGAGGC 0: 1
1: 0
2: 5
3: 58
4: 431
Right 922576741 1:226665868-226665890 GAAGCACCTGTGGTGGGGCCAGG 0: 1
1: 0
2: 1
3: 43
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922576741 Original CRISPR GAAGCACCTGTGGTGGGGCC AGG Intronic
900558449 1:3291668-3291690 GAAGCACCCGTGTTGGGTCAAGG + Intronic
900640450 1:3685787-3685809 GAAGCTGCTGTGCTGGGGCTGGG + Intronic
900695928 1:4010437-4010459 GAGGAGGCTGTGGTGGGGCCAGG + Intergenic
901240897 1:7692644-7692666 GAAGCACCAGGCCTGGGGCCTGG - Intronic
901463316 1:9404581-9404603 GAAGCCGCAGAGGTGGGGCCAGG + Intergenic
901701016 1:11044790-11044812 GCAGCAGGTGGGGTGGGGCCAGG + Intronic
901935428 1:12623038-12623060 GCAGGGCCTGGGGTGGGGCCTGG + Intergenic
902244047 1:15107700-15107722 GAGGCAGCGGTGGTGGGGCTAGG - Intronic
902338492 1:15767548-15767570 GCAGTACCTGTGGTGGGGGCGGG - Exonic
902396784 1:16136247-16136269 CCAGCCCCTGTGATGGGGCCAGG - Intronic
902409629 1:16205473-16205495 GATACACCTGTGGGCGGGCCGGG - Intronic
902722494 1:18313236-18313258 GATCCACCTGAGGTGGGGCAAGG - Intronic
903672747 1:25046177-25046199 GGAGGGCCTGGGGTGGGGCCCGG + Intergenic
904478328 1:30778480-30778502 GAAGCACTTGGAGTGGGGCCAGG - Intergenic
906652072 1:47519970-47519992 TAAGCACCTGGAGTGGGGCTGGG + Intergenic
907020369 1:51060729-51060751 CCAGCACCTGTGGTGGCACCTGG + Intergenic
907197181 1:52696465-52696487 AAAGAACCTGGGGTTGGGCCGGG - Intronic
907240192 1:53076988-53077010 GGACCACCTGTGGTGGGGCACGG + Intronic
907245047 1:53103159-53103181 GAAGCCCCTGGGGTGGGGTGGGG + Intronic
907827246 1:58030644-58030666 AAAGCCCCTGGGGTGGGGCCCGG + Intronic
908907164 1:69029184-69029206 GCAGTACCTGTGCTGGGGTCGGG - Intergenic
912522078 1:110252415-110252437 GCAAAACCTGTGGTTGGGCCTGG + Intronic
912550579 1:110482978-110483000 GAAACAGCTGTGGTGAGGCAGGG - Intergenic
912586578 1:110772195-110772217 GAAGCTCCTAGGGTGGGGCTGGG - Intergenic
915245319 1:154552213-154552235 GAAGCTCCTGAGGTGGAACCAGG - Intronic
915530748 1:156500872-156500894 GAGGCACCTGTGGGGGTGGCGGG + Intergenic
917299196 1:173555271-173555293 GCAGGAGCTGTGGTGGGGCCTGG + Intronic
917724525 1:177816165-177816187 GGAGCACCTGGGCTGGGGCTGGG - Intergenic
918023659 1:180720685-180720707 GAAACTTCTGGGGTGGGGCCTGG + Intronic
918468112 1:184842456-184842478 GAATCACTTGTGGTAAGGCCGGG + Intronic
918963332 1:191307153-191307175 GGAGCTGCTGTGATGGGGCCAGG - Intergenic
921870398 1:220133299-220133321 GAAATAACTGTGATGGGGCCGGG - Intronic
922576741 1:226665868-226665890 GAAGCACCTGTGGTGGGGCCAGG + Intronic
923008811 1:230072344-230072366 AAAGCAGGTGTGGTGGGGCGGGG + Intronic
923372331 1:233327321-233327343 GGAGCACCTGCGGCGGGGGCGGG + Intergenic
924787326 1:247210596-247210618 GAGGCAGCTGTGGGGAGGCCTGG + Intergenic
1065355792 10:24840215-24840237 GAAACACCTATGGCAGGGCCGGG - Intergenic
1066745868 10:38603997-38604019 GTAGCAGCTGTGGGGAGGCCTGG + Intergenic
1066753548 10:38685883-38685905 GAAAAACCTGTGGTGGGGTGTGG - Intergenic
1068814638 10:61295894-61295916 AGAGCACCAGTGGTGGGGTCAGG - Intergenic
1069102869 10:64345094-64345116 TAAACACCTGTGGTGAGGTCTGG + Intergenic
1069895659 10:71678769-71678791 AAGGCACCTGGAGTGGGGCCAGG - Intronic
1069913273 10:71772514-71772536 GGAGCCCCTGTGTTGGGGCCAGG + Intronic
1070833393 10:79433670-79433692 TGGGCACCTGTGCTGGGGCCAGG - Intronic
1071397867 10:85240658-85240680 GCAGCACATGTGGTAGGGCCAGG + Intergenic
1073327240 10:102650027-102650049 GAAGCCCCTGTGGTGGTGGGAGG - Intronic
1075070351 10:119316135-119316157 GAAGCCCCTGGGTTGGGGCCAGG - Intronic
1075125366 10:119694883-119694905 CAAGCACCTGTGGTGGCACCTGG - Intergenic
1075539917 10:123303702-123303724 AAAGCTGCTGTGGTGGGGCATGG + Intergenic
1076777588 10:132706674-132706696 GGAGCACTTGTGGTGGGGGCAGG + Intronic
1076801642 10:132833737-132833759 CAAGCACGTGTGGTGTGGCGGGG + Intronic
1076815279 10:132911497-132911519 GGAGCACCCGCGGTGGGGCGGGG - Intronic
1077919256 11:6630857-6630879 GAAGCACCTGTTGTGGACCGGGG + Exonic
1078869870 11:15333442-15333464 ACAGCAGCTGGGGTGGGGCCTGG - Intergenic
1079668291 11:23134968-23134990 GAAGCACCTGTGGTGAAGTGTGG - Intergenic
1080366737 11:31582876-31582898 GAGGCAACTGTGGTGGGGGCGGG + Intronic
1080518670 11:33046993-33047015 GAATCACCTGAGGTGAGGTCAGG + Intronic
1083006562 11:59351932-59351954 GAAGCATCTGTAGTGGAGCAGGG - Intergenic
1083235658 11:61349256-61349278 CAAGCAGCCATGGTGGGGCCAGG + Exonic
1083620723 11:64048139-64048161 GAGGCAGCTGTCGTGGGGGCAGG - Intronic
1083624771 11:64066917-64066939 GCAGCACCTGGGCTGGGGCGTGG - Intronic
1083924149 11:65795790-65795812 CAAACAACTGTGGTGGGGGCTGG + Exonic
1084178743 11:67436381-67436403 TCAGCACCTGGGGTGGGGCCTGG + Intronic
1084238864 11:67805489-67805511 GCGGGACCTGGGGTGGGGCCAGG + Intergenic
1084769210 11:71331778-71331800 GGGGCACCTGAGGTGGGGGCAGG + Intergenic
1084939789 11:72606463-72606485 GCATCTCCTGTGGTGGGGGCTGG - Intronic
1085254768 11:75166099-75166121 GACCCACCTGGGCTGGGGCCTGG - Intronic
1085476949 11:76794897-76794919 AAAGCACCTGTGGTCTGGCCGGG - Intronic
1085514811 11:77105932-77105954 GAAGCAGGTGTGGGTGGGCCAGG + Intronic
1085768796 11:79307233-79307255 GAAGCACGTGTTGTGGTGCTTGG + Intronic
1086508192 11:87527969-87527991 CCAGCACCTGTGCTGGTGCCTGG - Intergenic
1087061837 11:93986607-93986629 CAAGGTCCTGTGGTGGGGCAAGG - Intergenic
1089409410 11:118227057-118227079 GAAGCACCAGTGCTGGGTTCAGG + Exonic
1091085498 11:132718260-132718282 GTAGCACCAGTGGTGGGTTCAGG + Intronic
1091772425 12:3161558-3161580 GGAGCACCTAGCGTGGGGCCTGG + Intronic
1093176408 12:15918115-15918137 GAAGAACATCTGCTGGGGCCAGG - Intronic
1094017946 12:25884428-25884450 GAAGCCACTGTGATGGGGCCCGG + Intergenic
1094832890 12:34308512-34308534 GTAGCCCCTGTGCTGGGCCCCGG + Intergenic
1094836371 12:34324030-34324052 GCAGCCCCTGTGTTGGGCCCGGG - Intergenic
1094839663 12:34337654-34337676 GAGGGACGTGGGGTGGGGCCAGG - Intergenic
1094844247 12:34354493-34354515 GATGCACCTGTGGTGTGGCAAGG - Intergenic
1094852031 12:34386633-34386655 GAGGCACCTGTGGTGTGGAAGGG - Intergenic
1094856014 12:34403158-34403180 GAGGCACCTGTGTTGTGGACGGG + Intergenic
1095438938 12:42223649-42223671 AAAGCACTTCTGGTGGGGCGAGG - Intronic
1098290701 12:68954952-68954974 CCAGCACCTGTGCTGGTGCCTGG + Intronic
1098519546 12:71420379-71420401 CCAGCACCTGTGCTGGTGCCTGG - Intronic
1102144532 12:110645009-110645031 GAAGAGCCTGCTGTGGGGCCAGG + Exonic
1102656566 12:114487003-114487025 GAAGGCCCTGAGGTGGAGCCAGG + Intergenic
1104965635 12:132507728-132507750 GGAGCACTTCTTGTGGGGCCTGG + Intronic
1106469046 13:30038615-30038637 GAATCATCTGTGATGGGTCCAGG - Intergenic
1106512151 13:30421634-30421656 GAAGCACGGGCGGCGGGGCCCGG + Intergenic
1106519207 13:30482398-30482420 CAAGCGTCTATGGTGGGGCCAGG + Intronic
1106555365 13:30804179-30804201 GTAACTCCTGTGGAGGGGCCAGG - Intergenic
1108019426 13:46111676-46111698 GAAGCACCAGAGGTGAGGCTTGG - Intergenic
1110045878 13:70829805-70829827 GTATATCCTGTGGTGGGGCCAGG + Intergenic
1111337513 13:86841463-86841485 GAAGCCACTTTGGTGGGGCCAGG - Intergenic
1111549002 13:89783446-89783468 TCAGCACCTGTGGTGGTGCTTGG - Intergenic
1111684998 13:91490955-91490977 GAAGGACCTATGGTGGGGGAAGG - Intronic
1112687160 13:101843044-101843066 TAAGCACCTGTAGTGTGGCTGGG + Intronic
1113124068 13:106957186-106957208 GAAACACCTGTGGAGAGCCCAGG - Intergenic
1113593224 13:111514921-111514943 GCTGCACCTGTGCTGGTGCCTGG - Intergenic
1114678222 14:24459906-24459928 GAAGGGCCTGTGCTGGGGCCAGG - Intergenic
1114680101 14:24477070-24477092 GAAGCAGCTGTAATGAGGCCTGG - Intergenic
1115906464 14:38208480-38208502 TGGGCACCTGTGCTGGGGCCAGG + Exonic
1116151168 14:41144663-41144685 CCAGCACCTGTGCTGGGGCCTGG - Intergenic
1117896400 14:60491955-60491977 GAAGCACCTGTAGTTGTACCTGG - Intronic
1119441350 14:74630893-74630915 TGAGAACCTGTGGAGGGGCCAGG + Intergenic
1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG + Exonic
1121522737 14:94597586-94597608 GAGGCACCTGGGGTAGGGGCTGG + Intronic
1121568213 14:94926351-94926373 GCAGCACCTGGGCTGTGGCCGGG - Intergenic
1122325797 14:100880114-100880136 GAAGCAGATGTGGTGGGGGTGGG + Intergenic
1122799694 14:104223402-104223424 GAGGCAGCTGGGGTGGGGGCGGG - Intergenic
1123027978 14:105437574-105437596 GAGGACCCTGTGGAGGGGCCTGG - Intronic
1123031923 14:105456024-105456046 GAGGCCACTGTGCTGGGGCCCGG + Intronic
1124001843 15:25766689-25766711 GAAGCGGCTGGGTTGGGGCCTGG - Intronic
1125739468 15:41952104-41952126 AAGGCACCTGCGGAGGGGCCTGG + Intronic
1126686296 15:51251525-51251547 GAAGCACTTGTGGTAGCCCCCGG - Intronic
1127293682 15:57591885-57591907 GAAGGCCCGGGGGTGGGGCCGGG - Intergenic
1128147473 15:65340033-65340055 GTCGCACCTCTGGTGGGGGCAGG - Intronic
1128256750 15:66202547-66202569 GAGGCAGGTGTGCTGGGGCCAGG - Intronic
1128880452 15:71237528-71237550 GAAGCTGATGTGGTGGGTCCTGG - Intronic
1129210457 15:74065058-74065080 GCAGCAGCTGTGGGAGGGCCGGG - Intergenic
1129239994 15:74245422-74245444 GAAGCACAGGTGGTGGGAGCAGG + Intronic
1129403556 15:75300315-75300337 GCAGCAGCTGTGGGAGGGCCGGG + Intergenic
1129727654 15:77909690-77909712 GCAGCAGCTGTGGGAGGGCCAGG - Intergenic
1129840235 15:78739280-78739302 GCAGCAGCTGTGGGAGGGCCGGG + Intergenic
1133008535 16:2897714-2897736 GCAGGACCTGCTGTGGGGCCAGG - Intronic
1133017078 16:2948944-2948966 GACGCAGCTGTCGTGGGGCAGGG + Exonic
1133464857 16:6019499-6019521 GCAGCACCCGCGGTGGGGCGGGG + Intronic
1133746076 16:8687666-8687688 GAAAGGCCTGTGGTGGGGCTTGG + Intronic
1135588306 16:23688034-23688056 GAAGCACCAGCAGAGGGGCCAGG - Intronic
1136233973 16:28903468-28903490 GAAGGGGCTGTGGTGGGGCCAGG - Intronic
1136484258 16:30561261-30561283 GGAGCCCCTGTGGAGGAGCCTGG + Intergenic
1136737196 16:32475650-32475672 GTAGCAGCTGTGGGGAGGCCTGG - Intergenic
1137244254 16:46689599-46689621 GATGCGCCGGGGGTGGGGCCTGG + Intergenic
1138348127 16:56332306-56332328 GAAGCACACGTGGAGGGGCCAGG - Intronic
1139543506 16:67636651-67636673 GAAGCACAGGTGGTGGGGCAAGG - Intronic
1140169808 16:72592848-72592870 GAAGCACGTCTTGTGGGGGCAGG + Intergenic
1140908936 16:79433968-79433990 GCTCCACATGTGGTGGGGCCTGG - Intergenic
1141031723 16:80594965-80594987 GAACCACATGTGGTGTGGCATGG + Intergenic
1141660606 16:85439218-85439240 AAAGCCACTGAGGTGGGGCCCGG + Intergenic
1141993345 16:87622507-87622529 GCAGCAGCTGTGGCAGGGCCGGG + Intronic
1142342765 16:89534825-89534847 GAAGCACCTGTGGATGGGTCTGG - Intronic
1203015874 16_KI270728v1_random:353927-353949 GTAGCAGCTGTGGGGAGGCCTGG + Intergenic
1203034209 16_KI270728v1_random:627085-627107 GTAGCAGCTGTGGGGAGGCCTGG + Intergenic
1142534070 17:601534-601556 TTAGCCACTGTGGTGGGGCCAGG - Intronic
1143524963 17:7466548-7466570 GAGGCAGCTGTGGTGGTGGCAGG + Exonic
1143585598 17:7848803-7848825 GTAGCACCTGATGGGGGGCCAGG - Exonic
1144489848 17:15699595-15699617 GGAGCACCCGTGGTGCGGCTGGG - Intronic
1144722953 17:17484911-17484933 GAAGCACTTGTGGTGGCACTGGG + Intronic
1144777298 17:17791333-17791355 AAGGCACTTGTGGTGGGGTCCGG + Intronic
1145204506 17:20975701-20975723 GAAGTGCCTGTGGTGGGGAAAGG - Intergenic
1145270450 17:21401897-21401919 GAAGCACAAGGGGTGGGGCTTGG + Intronic
1145308660 17:21689294-21689316 GAAGCACAAGGGGTGGGGCTTGG + Intergenic
1146120463 17:30189336-30189358 GAAGAACCTGTACTGGGGCCAGG - Intergenic
1146528807 17:33590415-33590437 GAAGTACCTGTGCAGGGGGCTGG - Intronic
1146639313 17:34527915-34527937 GAAGCATGTGTGGTGGGGAAAGG - Intergenic
1146837631 17:36125214-36125236 GTAGCTCCTGTGGTGAGCCCGGG - Intergenic
1147133793 17:38423864-38423886 GAAGGGCCTGAGCTGGGGCCAGG + Intergenic
1148075405 17:44932707-44932729 GGAGGTCCTGTGGTGGGGGCTGG + Exonic
1148491503 17:48026469-48026491 GAAGAACCTGGGGTGGGGTGGGG + Exonic
1149039845 17:52174764-52174786 CATGTACCTTTGGTGGGGCCTGG + Intergenic
1149263457 17:54902579-54902601 GAACCACTTGAGGCGGGGCCCGG - Intronic
1149585299 17:57782420-57782442 CCAGCAGCTGTGGTGGCGCCAGG + Intergenic
1149728055 17:58916917-58916939 GAACTATCTGTGGTGGGGCACGG + Intronic
1151272509 17:73007805-73007827 GAAACATTTGTGGTTGGGCCAGG + Intronic
1152631894 17:81414204-81414226 GCAGGACCTGTGCTGGGGCAGGG + Intronic
1152782984 17:82234614-82234636 ACAGCACCTGTGGTGGGGACAGG + Exonic
1152838099 17:82548150-82548172 CAAGTACGAGTGGTGGGGCCAGG + Intronic
1203171223 17_GL000205v2_random:149141-149163 GAAGCAGGTCTGGTGGGGCTAGG + Intergenic
1154085627 18:11302945-11302967 GCAGCCCCTGTGCTGGGCCCCGG - Intergenic
1155783805 18:29873789-29873811 GAAGGATCTGGGGTGGGGTCTGG - Intergenic
1157160691 18:45311601-45311623 GAATGTCCAGTGGTGGGGCCAGG - Intronic
1157286421 18:46380257-46380279 GCAGAACCTGGGCTGGGGCCTGG + Intronic
1158349974 18:56554999-56555021 CAAGGACCTGAGCTGGGGCCAGG - Intergenic
1160377674 18:78426140-78426162 GAAGCACCTGTGGGGGGTTGGGG - Intergenic
1160835500 19:1122832-1122854 GAGGCCCCTGGGGAGGGGCCGGG - Intronic
1160991586 19:1862530-1862552 AGAGCACCTGGCGTGGGGCCAGG - Intronic
1161159986 19:2756607-2756629 GAAACACCTCTGGGGAGGCCCGG + Intronic
1161323912 19:3653822-3653844 GAAGCGCCTGCCTTGGGGCCTGG - Intronic
1161392207 19:4027332-4027354 GGTGCACCTGTGCTGAGGCCTGG + Intronic
1161898362 19:7099392-7099414 GTAGCACCTGGGGTGAGGGCGGG + Intergenic
1162022542 19:7874317-7874339 GAGTCGCCTGGGGTGGGGCCCGG + Exonic
1162449952 19:10748612-10748634 GAAGCCCCTGAGGTGGGTGCGGG + Intronic
1162523395 19:11194654-11194676 GAACCAGCTGTGGAGGGGGCTGG - Intronic
1162643987 19:12035458-12035480 GAACCGGCTGTGGTGGGACCCGG - Intronic
1162646303 19:12052717-12052739 GAACCCGCTGTGGCGGGGCCCGG - Intronic
1162657189 19:12140101-12140123 GAAGCGGCTGTGGTGGGATCTGG - Intronic
1162722536 19:12670838-12670860 GTAGCACCTGGGGTGAGACCAGG - Exonic
1162865235 19:13540890-13540912 GCAGAACCTGTGCTGGGTCCGGG - Intronic
1163105470 19:15120603-15120625 GAAGGACCTGTGCAGGGCCCTGG + Intronic
1163557912 19:18002679-18002701 GAAGCAAGTGCGGTGGGGCAGGG + Intronic
1163593477 19:18207100-18207122 GAAGGCCCTGTGGTGGGACCAGG + Intergenic
1163648469 19:18503529-18503551 GATGAACATGTGGTGGGGCCGGG - Intronic
1163730807 19:18948225-18948247 AAAGGCCCTGAGGTGGGGCCAGG + Intergenic
1164999443 19:32749070-32749092 GAAACACCTGGGGTGCTGCCTGG + Intronic
1165091203 19:33389273-33389295 GAGGCAAGTGTTGTGGGGCCGGG - Intronic
1165324746 19:35107957-35107979 GATTCATCTGTGGCGGGGCCTGG + Intergenic
1165466362 19:35977346-35977368 GAAGCATATGAGGTGGGGGCTGG - Intergenic
1165854619 19:38871864-38871886 GACACACCTGTGGTGGGGGGAGG + Exonic
1166228973 19:41414566-41414588 ACAGCACCTGAGGAGGGGCCAGG - Intronic
1166668739 19:44697462-44697484 GGAGCACCAGAGGAGGGGCCAGG + Intergenic
1166782674 19:45350625-45350647 GAAGGGCCTGGGGAGGGGCCGGG - Exonic
925917283 2:8615715-8615737 GAAGCCTCTGGGGTGGGGTCGGG - Intergenic
926798474 2:16638360-16638382 GAAGCATCCGTGGTGGGCACCGG + Intronic
927171608 2:20375160-20375182 GAAGCACCAGGAGTGGCGCCAGG - Intergenic
927955421 2:27204403-27204425 GACACTCCTGTTGTGGGGCCAGG + Intronic
929195406 2:39179720-39179742 GAGGCACTGGAGGTGGGGCCCGG + Intronic
930728833 2:54708994-54709016 GGAGCCCCCATGGTGGGGCCAGG + Intergenic
930748199 2:54906380-54906402 GATGCTGCTGTGGAGGGGCCTGG + Intronic
931682528 2:64763494-64763516 ATAGCTCCTGAGGTGGGGCCAGG + Intergenic
934188330 2:89764765-89764787 GTAGCAGCTGTGGGGAGGCCTGG - Intergenic
934308271 2:91843190-91843212 GTAGCAGCTGTGGGGAGGCCTGG + Intergenic
934777985 2:96950998-96951020 GAAGCACTTGTTGAGGGGCTTGG + Intronic
935336568 2:102022276-102022298 CACGCACCTGTGGGGGTGCCTGG + Intronic
935533262 2:104261458-104261480 GGAGTACCTGTGGTGTGGCATGG - Intergenic
935875402 2:107501144-107501166 GAAGCACCTGAGGAGGGGTGGGG - Intergenic
936090702 2:109499677-109499699 AAAGCAGCTGTGGTGGCCCCAGG - Intronic
936267352 2:111020747-111020769 GAACCAGCTGTGTTGGGGCCTGG + Intronic
937287628 2:120763148-120763170 AAAGGGCCTGTGGTGGGGGCAGG - Intronic
937294832 2:120803780-120803802 GCAGCCCCTGGGCTGGGGCCTGG + Intronic
937847871 2:126601452-126601474 GAGTCACCTGTGGGGAGGCCTGG + Intergenic
939868634 2:147503327-147503349 AAAGCACGGGTGGTGGGGCCGGG + Intergenic
943279760 2:185916961-185916983 GAAGTACCTGAGGCTGGGCCTGG - Intergenic
946456439 2:219830466-219830488 GAAGCTCTGGGGGTGGGGCCCGG - Intergenic
947634752 2:231674309-231674331 GAAGGGCCTGTGGTGAGGACAGG - Intergenic
947731608 2:232434500-232434522 GAGGCAGCTGGGGTGTGGCCAGG + Intergenic
948531812 2:238613702-238613724 GCAGCTCCAGTGCTGGGGCCAGG + Intergenic
948638212 2:239354283-239354305 GAAGCTCCTGAAGTGGGGCGGGG - Intronic
948915537 2:241033472-241033494 GAAACACCTGGGGTGGGTGCGGG - Intronic
1169071563 20:2735702-2735724 TCAGCACCTGTTGTGGGGCTGGG + Intronic
1169465594 20:5835474-5835496 GCAGAAGCTGTGGTGGGGGCTGG + Intronic
1171101630 20:22389112-22389134 GAGGAAACTGTGGTGTGGCCAGG + Intergenic
1172313645 20:33936733-33936755 GATTGACCTGGGGTGGGGCCTGG + Intergenic
1172627765 20:36358004-36358026 GAAGCAACTGTGGTGGATTCAGG + Intronic
1173147136 20:40534649-40534671 TTAGCACCTGTGGTTGGGCTGGG + Intergenic
1173836984 20:46132387-46132409 GAAGCACCAGTGGTGGAGAGGGG - Intergenic
1174194964 20:48766534-48766556 GGAGCACCTGTGCTGAGGCCTGG - Intronic
1174202202 20:48814560-48814582 GAAAGAAATGTGGTGGGGCCTGG + Intronic
1174547544 20:51337045-51337067 GAAGGGCCTGCTGTGGGGCCTGG - Intergenic
1175199470 20:57267539-57267561 GAAGCCCTAGTGGTGGGGCTGGG - Intergenic
1175331795 20:58169780-58169802 GAAGGAACTGTTGTGGGGTCTGG - Intergenic
1175743344 20:61435999-61436021 AAAGGTCCTGTGGTGGGGCTGGG - Intronic
1175872398 20:62214634-62214656 GAGGCACCTGTCCTGGGGGCAGG + Intergenic
1176079872 20:63266958-63266980 GAAGCACGTGAGGTTGGCCCGGG - Intronic
1176232757 20:64040463-64040485 GAGGCAGCTGAGTTGGGGCCTGG + Intronic
1176327205 21:5510971-5510993 GAAGCAGGTCTGGTGGGGCTAGG + Intergenic
1176364901 21:6026861-6026883 GAAGCACTGGTGCTGGGGGCAGG - Intergenic
1176400552 21:6309980-6310002 GAAGCAGGTCTGGTGGGGCTAGG - Intergenic
1176436605 21:6679124-6679146 GAAGCAGGTCTGGTGGGGCTAGG + Intergenic
1176460867 21:7006194-7006216 GAAGCAGGTCTGGTGGGGCTAGG + Intergenic
1176484428 21:7387972-7387994 GAAGCAGGTCTGGTGGGGCTAGG + Intergenic
1178723151 21:35027742-35027764 AAAGAACCTGTGGTTGGGCTGGG - Intronic
1178924864 21:36766581-36766603 GAAGCACATGTGGGTGAGCCTGG + Intronic
1179211673 21:39330136-39330158 GATGCACCTGTGGCCGGGCGTGG - Intergenic
1179268868 21:39832516-39832538 GAGGCCCCTATGATGGGGCCAGG + Intergenic
1179758617 21:43511684-43511706 GAAGCACTGGTGCTGGGGGCAGG + Intergenic
1180535355 22:16390269-16390291 GTAGCAGCTGTGGGGAGGCCTGG + Intergenic
1180949708 22:19715494-19715516 GAGGCCCCTGGGGTGGGGCGGGG + Intronic
1181283329 22:21735508-21735530 GAAGCACCTGTTGGGCGTCCGGG - Intronic
1181523232 22:23461021-23461043 GAAGCCCCAGAGCTGGGGCCCGG - Intergenic
1181661165 22:24350037-24350059 GAAGCCCATGTGGTGAGGCAGGG - Intronic
1183354568 22:37351278-37351300 GAAGCTCCTGGGGTGGGGGCAGG - Intergenic
1183410972 22:37655039-37655061 GGAGCAGCTGGGGTGGGGCATGG + Intronic
1183772673 22:39939980-39940002 GAAGCACTGGTGGGGGGCCCAGG + Intronic
1184652533 22:45925730-45925752 GCAGCTCCTGGGGTGGCGCCTGG - Intronic
1184961757 22:47934243-47934265 GAAGCTCCTCTGGTGGGGGAAGG - Intergenic
1184993573 22:48186409-48186431 GTAACACCTGGGGTGGGGGCCGG + Intergenic
950450046 3:13060376-13060398 CAGGCTCCTGCGGTGGGGCCCGG + Intronic
953108555 3:39909741-39909763 TCAGGACCTGTGGTGGGGCAGGG + Intronic
954439899 3:50516167-50516189 GAAGCCCCTGGGGAGGGGCAAGG - Intergenic
956975694 3:74575960-74575982 GAAGTACTTGTGGTGGAGCTAGG - Intergenic
960993829 3:123328505-123328527 CAAGCACCTGTGGGGGCGCTGGG - Intronic
961430025 3:126874890-126874912 GGAGCATGTGAGGTGGGGCCAGG - Intronic
961556030 3:127697177-127697199 GCACCCCCTGTGGTTGGGCCTGG - Intronic
963526447 3:146421045-146421067 GAAGCAGCTGTGATGGGCCATGG + Intronic
964475738 3:157096171-157096193 AAAAGAACTGTGGTGGGGCCAGG - Intergenic
965652378 3:170947438-170947460 GAGGCAGCTGAGGTGAGGCCTGG - Intergenic
967129508 3:186457652-186457674 GCAGCACCTTTTGAGGGGCCCGG + Intergenic
967411870 3:189174375-189174397 ATAACACCTGTGCTGGGGCCGGG + Intronic
968762810 4:2451155-2451177 GAAGCACCTGGGCAGGGGGCAGG + Intronic
968982300 4:3856855-3856877 GCAGCAGCTGTGATGGGGGCAGG - Intergenic
969016379 4:4106890-4106912 GAGGGGCCTGTGGTGGGGGCAGG - Intergenic
969450283 4:7269003-7269025 GAAGCACATGGGCTGGGGCCTGG + Intronic
969614488 4:8244445-8244467 GGAGCACCTCTGGGAGGGCCTGG - Intergenic
969622719 4:8286809-8286831 GAAGCACCTGGGGCTGGGCATGG + Intronic
973026790 4:45283580-45283602 CCAGCACCTGTGCTGGTGCCTGG - Intergenic
974199932 4:58623985-58624007 GAAGCATCTGTAGTGGAGCATGG + Intergenic
974521503 4:62987015-62987037 CCAGCACCTGTGATGGTGCCTGG - Intergenic
974806121 4:66882908-66882930 GGAGAACCTCTGGTGGGGCAGGG + Intergenic
975093081 4:70426052-70426074 AGAGCAACTGTGGTGGGGGCTGG - Intergenic
979690451 4:123553561-123553583 GAACCACCTGGGGTCTGGCCAGG + Intergenic
980014321 4:127631378-127631400 GAATCTCCAGTGGAGGGGCCTGG - Intronic
982368201 4:154603774-154603796 CAAACACCTGTGGTGGGACCTGG - Intergenic
982694882 4:158588497-158588519 GAGGCAGCTGTGTTGGGGGCGGG - Intronic
984754742 4:183314551-183314573 CAAGCAGCTGGGGTGGTGCCGGG - Intronic
987139344 5:14929518-14929540 GAAGCTCCTGTGCTTGGGACCGG + Intergenic
988472891 5:31557343-31557365 GAAGCCCCTGTGGCCGGGCGCGG + Intergenic
989131161 5:38107623-38107645 GAATCTCCTGAGGTGGGGCCAGG - Intergenic
990636613 5:57735204-57735226 GCAGAACCTGTGGTATGGCCTGG + Intergenic
992530555 5:77647848-77647870 GAAGCAGCTGTGGTAGGGAAGGG + Intergenic
995854491 5:116577189-116577211 GGAGCACCTGTGGGGAAGCCAGG + Intergenic
997598097 5:135120623-135120645 GAGACACCTGAGGTGGGGCCAGG + Intronic
997611517 5:135218807-135218829 GAAACACCTGGGGAGGGGCTGGG - Intronic
998487936 5:142519797-142519819 GAGTGACCTGTGGTGGGTCCTGG - Intergenic
999743859 5:154576849-154576871 GAAGCTCCAGTGATGGGTCCTGG - Intergenic
999849907 5:155526723-155526745 AAAGCACCTGTGGCCGGGCTAGG - Intergenic
999887052 5:155935948-155935970 CCAGCACCTGTGCTGGTGCCTGG - Intronic
1000210558 5:159103548-159103570 GAACCTCCTGTGTTGGTGCCTGG + Intergenic
1000585167 5:163088403-163088425 GAAGCGACTGTGGTGGGGAGTGG - Intergenic
1000946546 5:167429397-167429419 GCAGCACCTGTAGCAGGGCCTGG - Intronic
1001462769 5:171932822-171932844 GAATAAACTGTGGTAGGGCCAGG + Intronic
1002596680 5:180328392-180328414 GACGCACCTGGGCTGTGGCCAGG - Intronic
1004110291 6:12711252-12711274 GAAGCAGCTGGAGTGGTGCCTGG - Intergenic
1004392154 6:15218870-15218892 GAACCACAGGTGGTGGGGGCTGG + Intergenic
1004525620 6:16404651-16404673 GGTGCACATGTGGTGGGGGCTGG - Intronic
1004742365 6:18474702-18474724 TAAGAACTTGTGGTGGGGCATGG + Intergenic
1004917037 6:20341778-20341800 GGAGCACCTGTGATGGTGCCAGG - Intergenic
1006010763 6:31041156-31041178 TTATCACCTGTGGTGGTGCCTGG - Intergenic
1006142466 6:31938389-31938411 GAAGCACCTGGCCTGGTGCCTGG + Intronic
1006362222 6:33593041-33593063 GTACCACCTGGGGCGGGGCCTGG - Intergenic
1006798241 6:36744196-36744218 GAAACATCTGGGGTGGGGGCAGG + Intronic
1007812145 6:44494042-44494064 GAAGCACATGGTGTTGGGCCTGG + Intergenic
1010547180 6:77172990-77173012 GGAGCACCTGTAGTGGAGCATGG - Intergenic
1010815060 6:80348450-80348472 GAACCACATGTGGTGGGGAGAGG - Intergenic
1011310338 6:85973916-85973938 GAAGGAGCTGTGGGGAGGCCTGG + Intergenic
1012394321 6:98778371-98778393 GAAGCAGAGGTGGTGGGGCAGGG + Intergenic
1016988518 6:149912877-149912899 GGAGCACCCTTGGTGGGACCTGG - Intergenic
1017720288 6:157238997-157239019 GCAGGCCCTGTGGAGGGGCCAGG + Intergenic
1017727132 6:157283617-157283639 GAAGCTCTGGGGGTGGGGCCAGG + Intergenic
1018093360 6:160363774-160363796 GCAGCCCCTGTGCTGGGGGCAGG - Intronic
1018636302 6:165862043-165862065 GCAGCCACTGTGGTGGGGCCAGG + Intronic
1018860395 6:167707058-167707080 GAGGCTTCTGTGGTGGGGCTGGG - Intergenic
1019095277 6:169574764-169574786 GAAGCCACTGTGGAGGGGCCAGG + Intronic
1019325549 7:436585-436607 GCAGCACCCGGGGTGGGGCCTGG + Intergenic
1019493215 7:1324608-1324630 GAAGGGGCTGGGGTGGGGCCAGG + Intergenic
1019539935 7:1546942-1546964 GGAGGACCTGTAGGGGGGCCTGG - Exonic
1019610798 7:1935806-1935828 GGCTCATCTGTGGTGGGGCCTGG - Intronic
1020076167 7:5260409-5260431 GAAGCACCTCCGGTGGGGCCTGG - Intergenic
1020474746 7:8582070-8582092 CCAGCACCTGTGCTGGTGCCCGG - Intronic
1021677781 7:23098143-23098165 CCAGCACCTGTGCTGGCGCCTGG + Intergenic
1022014285 7:26335611-26335633 GACACATCTGTGGTGGTGCCAGG - Intronic
1022112747 7:27241381-27241403 CAAGCAAGTGTGCTGGGGCCAGG - Intergenic
1022174883 7:27863336-27863358 GAAGGCCCTGTGGCGGGGACAGG - Intronic
1022259654 7:28691876-28691898 GAAGCAGCTGTGGCTGGGCGTGG + Intronic
1022348050 7:29537689-29537711 GGAGCACCCATGGTGGGGCATGG + Intergenic
1023346842 7:39279263-39279285 GTGGCACCTGTGTTGGGGCTTGG - Intronic
1023526912 7:41114086-41114108 TAAGCATGTGTGGTGGGGGCAGG + Intergenic
1023966753 7:44966890-44966912 GAAGCCCCTGGTGTGGGGCAGGG - Intronic
1024844973 7:53632941-53632963 GAAGCACCTGTGCTGGAGGCTGG + Intergenic
1025202922 7:56973162-56973184 GAAGCATCTCCGGTGGGGCCTGG + Intergenic
1025669022 7:63603764-63603786 GAAGCATCTCCGGTGGGGCCTGG - Intergenic
1029005332 7:97203270-97203292 GAAACACCTGTGGCTGGGCGCGG + Intergenic
1032983124 7:137307861-137307883 GAAGCAGCTGTGGAGGGGGTTGG - Intronic
1035296353 7:157868891-157868913 CTAGCACCAGTGGTGAGGCCAGG + Intronic
1035395589 7:158532897-158532919 GGAGCAGGTGTGGTGGAGCCTGG - Intronic
1036183536 8:6605100-6605122 CAAGCACCTGCTGTGGGACCAGG - Intronic
1036899145 8:12658743-12658765 GAGGGGCCTGTGGTGGGGGCAGG - Intergenic
1037939673 8:22942136-22942158 AATTCACCTGGGGTGGGGCCAGG - Intronic
1038327915 8:26586559-26586581 GATGCTCCTGTGGTGGGGAAGGG - Intronic
1038516166 8:28189305-28189327 GTAGCACCTAAGGTGGTGCCTGG + Intronic
1041205641 8:55495539-55495561 GAAGCCACTGTGATGGGGCTGGG - Intronic
1043656493 8:82674236-82674258 GGAGCACCTGGGGTGGAGCATGG + Intergenic
1044698930 8:94949238-94949260 GAGGTAGCTGCGGTGGGGCCGGG + Exonic
1047928201 8:129701561-129701583 TCAGCAGCAGTGGTGGGGCCAGG - Intergenic
1048959185 8:139561815-139561837 GAATTACCTGTGATAGGGCCGGG + Intergenic
1049181743 8:141226484-141226506 CCAGCACCTGGGGTGGCGCCAGG - Intronic
1049189378 8:141278488-141278510 TGAGCACCTGTGGTGGAGGCGGG + Intronic
1049261360 8:141640883-141640905 CAAGCAGCTCTGGTGGGTCCTGG - Intergenic
1049527668 8:143136539-143136561 GAAGCAGCAGTGCAGGGGCCGGG - Intergenic
1049556158 8:143283283-143283305 GAATCCCTTGGGGTGGGGCCTGG - Intergenic
1051371597 9:16363907-16363929 GAAGCTGGTGGGGTGGGGCCGGG + Intergenic
1052991641 9:34522216-34522238 TAAGCAGCTCTGGTGTGGCCTGG + Intronic
1054756916 9:68968222-68968244 TAAGGACCTGTTCTGGGGCCAGG + Intronic
1057023272 9:91717485-91717507 GAAGAGCCTGCCGTGGGGCCTGG + Intronic
1058423461 9:104855604-104855626 GAAGAGCCTGGTGTGGGGCCTGG - Intronic
1058746366 9:107995123-107995145 GAAGCAGCTATGGTGGGATCAGG + Intergenic
1059481929 9:114597750-114597772 GAAGCACCTGTGCTGTGGAGTGG + Exonic
1061410503 9:130418756-130418778 GGAGCACCTGTGGGAGGCCCAGG - Exonic
1061888762 9:133606602-133606624 GATGCACCCGTGGTCTGGCCTGG + Intergenic
1062050118 9:134442836-134442858 CAGGCACCTGCGGTGGGGGCAGG + Intergenic
1062086629 9:134652538-134652560 GTCGCACCTGGGGTGGGGGCAGG + Intronic
1062273442 9:135720083-135720105 GCAGCAACTGTGGATGGGCCAGG + Intronic
1062394046 9:136345592-136345614 GAAGCAGCTGTGCCGGGCCCAGG + Intronic
1062569988 9:137180578-137180600 GGAGCACCTGTGGCAGGGCACGG + Intronic
1062710249 9:137971602-137971624 GAAGCACCTGAGGGAGGGACGGG - Intronic
1203434908 Un_GL000195v1:129535-129557 GAAGCAGGTCTGGTGGGGCTAGG - Intergenic
1186588660 X:10904220-10904242 GAACAGACTGTGGTGGGGCCAGG + Intergenic
1187014446 X:15311895-15311917 ACAGCACTTCTGGTGGGGCCTGG - Intronic
1187254639 X:17630875-17630897 GAATCACTGGAGGTGGGGCCTGG - Intronic
1187354679 X:18556582-18556604 GAAGCACTTAGGGTGGGGCTTGG + Intronic
1187445256 X:19355508-19355530 AGGACACCTGTGGTGGGGCCGGG + Intronic
1187899987 X:24018650-24018672 GAAGCCCCTTTAGTGGGGACTGG - Intronic
1189479862 X:41384259-41384281 GAAGTAGCTGGGGTGGGGGCAGG - Intergenic
1190007545 X:46755016-46755038 GCAGCTCCAGTGGTGGGGTCTGG + Intronic
1190282475 X:48940117-48940139 CAAGCAGCTGTGGTGTGACCTGG + Intronic
1191253739 X:58271009-58271031 GCAGCCCCTGTGCTGGGCCCGGG - Intergenic
1191258821 X:58291662-58291684 GCAGCACTTGTGCTGGGCCCAGG + Intergenic
1194325352 X:92508514-92508536 GAAGGTCCTGTGGTTTGGCCAGG - Intronic
1200111482 X:153743120-153743142 GTAGCAGCTGTGGGGAGGCCTGG + Intronic
1200634081 Y:5627677-5627699 GAAGGTCCTGTGGTTTGGCCAGG - Intronic
1201764849 Y:17566877-17566899 GCAGCCCCTGTGTTGGGGCCGGG - Intergenic
1201836703 Y:18339112-18339134 GCAGCCCCTGTGTTGGGGCCGGG + Intergenic