ID: 922577550 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:226672660-226672682 |
Sequence | GAGATCCTTAGGCCTTTAGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 119 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 5, 4: 113} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
922577550_922577555 | -7 | Left | 922577550 | 1:226672660-226672682 | CCCTCTAAAGGCCTAAGGATCTC | 0: 1 1: 0 2: 0 3: 5 4: 113 |
||
Right | 922577555 | 1:226672676-226672698 | GGATCTCAGCAACAGGGAAGTGG | 0: 1 1: 1 2: 1 3: 31 4: 278 |
||||
922577550_922577557 | -3 | Left | 922577550 | 1:226672660-226672682 | CCCTCTAAAGGCCTAAGGATCTC | 0: 1 1: 0 2: 0 3: 5 4: 113 |
||
Right | 922577557 | 1:226672680-226672702 | CTCAGCAACAGGGAAGTGGGAGG | 0: 1 1: 0 2: 1 3: 32 4: 356 |
||||
922577550_922577556 | -6 | Left | 922577550 | 1:226672660-226672682 | CCCTCTAAAGGCCTAAGGATCTC | 0: 1 1: 0 2: 0 3: 5 4: 113 |
||
Right | 922577556 | 1:226672677-226672699 | GATCTCAGCAACAGGGAAGTGGG | 0: 1 1: 0 2: 2 3: 20 4: 214 |
||||
922577550_922577558 | 25 | Left | 922577550 | 1:226672660-226672682 | CCCTCTAAAGGCCTAAGGATCTC | 0: 1 1: 0 2: 0 3: 5 4: 113 |
||
Right | 922577558 | 1:226672708-226672730 | TCATGCCAGAGATAAAGAGCTGG | 0: 1 1: 0 2: 1 3: 15 4: 199 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
922577550 | Original CRISPR | GAGATCCTTAGGCCTTTAGA GGG (reversed) | Intronic | ||