ID: 922577550

View in Genome Browser
Species Human (GRCh38)
Location 1:226672660-226672682
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922577550_922577555 -7 Left 922577550 1:226672660-226672682 CCCTCTAAAGGCCTAAGGATCTC 0: 1
1: 0
2: 0
3: 5
4: 113
Right 922577555 1:226672676-226672698 GGATCTCAGCAACAGGGAAGTGG 0: 1
1: 1
2: 1
3: 31
4: 278
922577550_922577557 -3 Left 922577550 1:226672660-226672682 CCCTCTAAAGGCCTAAGGATCTC 0: 1
1: 0
2: 0
3: 5
4: 113
Right 922577557 1:226672680-226672702 CTCAGCAACAGGGAAGTGGGAGG 0: 1
1: 0
2: 1
3: 32
4: 356
922577550_922577556 -6 Left 922577550 1:226672660-226672682 CCCTCTAAAGGCCTAAGGATCTC 0: 1
1: 0
2: 0
3: 5
4: 113
Right 922577556 1:226672677-226672699 GATCTCAGCAACAGGGAAGTGGG 0: 1
1: 0
2: 2
3: 20
4: 214
922577550_922577558 25 Left 922577550 1:226672660-226672682 CCCTCTAAAGGCCTAAGGATCTC 0: 1
1: 0
2: 0
3: 5
4: 113
Right 922577558 1:226672708-226672730 TCATGCCAGAGATAAAGAGCTGG 0: 1
1: 0
2: 1
3: 15
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922577550 Original CRISPR GAGATCCTTAGGCCTTTAGA GGG (reversed) Intronic